Prev. |  KEGG KO K05870 > 

RIKEN DNA Bank Human Resource - CREB1

Gene ID NCBI Gene 1385 |  KEGG hsa:1385
Gene Symbol CREB1
Protein Name cAMP responsive element binding protein 1
Synonyms CREB|CREB-1
Featured content Circadian clock (human)
Featured content Huntington disease - human
Ortholog resource in our bank

  CREB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07501 pCMFlag_hsCREB1, transcript variant A Expression vector of human CREB1.
RDB07505 pCMFlag_hsCREB1, transcript variant B Expression vector of human CREB1.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005490 IRAK013M02 pCMV-SPORT6 BC010636 NM_134442 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR075351 ARe88G07 pKA1U5 NM_004379.3  
GACTGGGCGGCGCTGGCTGGCTCCCTGGCTGCGGCTCCTCAGNTCGGCGGCGGCTGCTGC
HKR234347 ARiS085O11 pGCAP10 NM_004379.3  
GGGCTGGCTCCCTGGCTGCGGCTCCTCAGTCGGCGGCGGCTGCTGCTGCCTGTGGCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl