Prev. |  KEGG KO K00624 > 

RIKEN DNA Bank Human Resource - CRAT

Gene ID NCBI Gene 1384 |  KEGG hsa:1384
Gene Symbol CRAT
Protein Name carnitine O-acetyltransferase
Synonyms CAT|CAT1|NBIA8
Ortholog resource in our bank

  CRAT

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082949 IRAL007G05 pOTB7 BC000723 NM_144782 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE043549 W01A108O13 pENTR-TOPO IRAL007G05 BC000723 NM_144782  
HGE043553 W01A108O17 pENTR-TOPO IRAL007G05 BC000723 NM_144782  
HGE043557 W01A108O21 pENTR-TOPO IRAL007G05 BC000723 NM_144782  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR060575 ARe51H07 pKA1U5 NM_000755.3  
GGCCCCCGCCCCACAGCCAACCTCCCGGGCACCGTTGCCCGCCCGGGGCCCGCTACCGGC
HKR219838 ARiS049J22 pGCAP10 NM_000755.3  
GAGCCAACCTCCCGGGCACCGTTGCCCGCCCGGGGCCCGCTACCGGCCCAGGCCCCGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl