Prev. |  KEGG KO K17289 > 

RIKEN DNA Bank Human Resource - CRABP2

Gene ID NCBI Gene 1382 |  KEGG hsa:1382
Gene Symbol CRABP2
Protein Name cellular retinoic acid binding protein 2
Synonyms CRABP-II|RBP6
Ortholog resources KEGG ortholog (KEGG orthology K17289) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081569 IRAL003P09 pOTB7 BC001109 NM_001878 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000408 W01A001A08 pENTR-TOPO IRAL003P09 BC001109 NM_001878  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR321728 RBb04F08 pKA1U5 NM_001878.2  
GAGCTTTGGGGTTGTCCCTGGACTTGTCTTGGTTCCAGAACCTGACGACCCGGCGACGGC
HKR339325 RBb48F05 pGCAP1 NM_001878.2  
AGCTTTGGGGTTGTCCCTGGACTTGTCTTGGTTCCAGAACCTGACGACCCGGCGACGGCG
HKR367698 RBd19E02 pGCAP10 NM_001878.2  
GAGCTTTGGGGTTGTCCCTGGACTTGTCTTGGTTCCAGAACCTGACGACCCGGCGACGGC
HKR373350 RBd33G06 pGCAP10 NM_001878.2  
GAGCTTTGGGGTTGTCCCTGGACTTGTCTTGGTTCCAGAACCTGACGACCCGGCGACGGC
HKR379748 RBd49G04 pGCAP10 NM_001878.2  
GAGCTTTGGGGTTGTCCCTGGACTTGTCTTGGTTCCAGAACCTGACGACCCGGCGACGGC
HKR408818 RBdS022A18 pGCAP10 NM_001878.2  
GAGCTTTGGGGTTGTCCCTGGACTTGTCTTGGTTCCAGAACCTGACGACCCGGCGACGGC
HKR441959 RBdS104O23 pGCAP10 NM_001878.2  
AGAGCTTTGGGGTTGTCCCTGGACTTGTCTTGGTTCCAGAACCTGACGACCCGGCGACGG
HKR471099 RBdS177M11 pGCAP10 NM_001878.2  
GAGCTTTGGGGTTGTCCCTGGACTTGTCTTGGTTCCAGAACCTGACGACCCGGCGACGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl