Prev. |  KEGG KO K01294 > 

RIKEN DNA Bank Human Resource - CPE

Gene ID NCBI Gene 1363 |  KEGG hsa:1363
Gene Symbol CPE
Protein Name carboxypeptidase E
Synonyms CPH
Ortholog resource in our bank

  CPE

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027482 IRAK068L18 pCMV-SPORT6 BC033866 NM_001873 Full
HGX046250 IRAK115K10 pCMV-SPORT6 BC053612 NM_001873 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE094011 M01C035A11 pDONR221 MGC07-A06 BC033866 NM_001873  
HGE094059 M01C035C11 pDONR221 MGC07-A06 BC033866 NM_001873  
HGE094107 M01C035E11 pDONR221 MGC07-A06 BC033866 NM_001873  
HGE094155 M01C035G11 pDONR221 MGC07-A06 BC033866 NM_001873  
HGE094203 M01C035I11 pDONR221 MGC07-A06 BC033866 NM_001873  
HGE094251 M01C035K11 pDONR221 MGC07-A06 BC033866 NM_001873  
HGE094299 M01C035M11 pDONR221 MGC07-A06 BC033866 NM_001873  
HGE094347 M01C035O11 pDONR221 MGC07-A06 BC033866 NM_001873  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR076810 ARe92A10 pKA1U5 NM_001873.2  
GAGTAGTGCAGCCCGCTGGAGCCGCGGCTTTGCCCGTCTCCTCTGGGTGGCCCCAGTGCG
HKR325209 RBb13A09 pKA1U5 NM_001873.2  
GGAGTAGAGGCTGGTGCGGAACTTGCCGCCCCCCNCTNNCNCCGGTGGGCATAAGCCCAT
HKR371726 RBd29F06 pGCAP10 NM_001873.2  
GAGTGCGCGGGCTGACACTCATTCAGCCGGGGAAGGTGAGGCGAGTAGAGGCTGGTGCGG
HKR452891 RBdS132D19 pGCAP10 NM_001873.2  
GAGTGCGCGGGCTGACACTCATTCAGCCGGGGAAGGTGAGGCGAGTAGAGGCTGGTGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl