Prev. |  KEGG KO K07752 > 

RIKEN DNA Bank Human Resource - CPD

Gene ID NCBI Gene 1362 |  KEGG hsa:1362
Gene Symbol CPD
Protein Name carboxypeptidase D
Synonyms GP180
Ortholog resources KEGG ortholog (KEGG orthology K07752) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY019451 IRAK048K11 pBluescriptR BC051702 NM_001304 Full
HGY025221 IRAK063A21 pBluescriptR BC045624 NM_001304 Full
HGY042524 IRAK106F04 pBluescript BC045549 NM_001304 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR376924 RBd42F04 pGCAP10 NM_001304.3  
TGGGGGGTTAGCGGCGCTGCTGGAAGATGGCGAGCGGCCGGGACGAGCGGCCGCCTTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl