Prev. |  KEGG KO K02258 > 

RIKEN DNA Bank Human Resource - COX11

Gene ID NCBI Gene 1353 |  KEGG hsa:1353
Gene Symbol COX11
Protein Name COX11, cytochrome c oxidase copper chaperone
Synonyms COX11P
Ortholog resources KEGG ortholog (KEGG orthology K02258) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088478 IRAL021D06 pDNR-LIB BC005895 NM_004375 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR234960 ARiS087G16 pGCAP10 NM_004375.2  
GAGAGGGTTATGGGAGGGCTCTGGCGTCCTGGATGGAGGTGCGTTCCTTTCTGTGGCTGG
HKR384975 RBd62H07 pGCAP10 NM_004375.2  
TGATGGGAGGGCTCTGGCGTCCTGGATGGAGGTGCGTTCCTTTCTGTGGCTGGCGCTGGA
HKR406347 RBdS015O11 pGCAP10 NM_004375.2  
GAGAGGGTTATGGGAGGGCTCTGGCGTCCTGGATGGAGGTGCGTTCCTTTCTGTGGCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl