Prev. |  KEGG KO K02273 > 

RIKEN DNA Bank Human Resource - COX8A

Gene ID NCBI Gene 1351 |  KEGG hsa:1351
Gene Symbol COX8A
Protein Name cytochrome c oxidase subunit 8A
Synonyms COX|COX8|COX8-2|COX8L|VIII|VIII-L
Ortholog resources KEGG ortholog (KEGG orthology K02273) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB13329 pYNL-N1_Mito Yellow Nano-lantern for labeling of mitochondria by the mitochondrial targeting sequence from subunit VIII of human cytochrome c oxdase.
RDB13330 pCNL-N1_Mito Cyan Nano-lantern for labeling of mitochondria by the mitochondrial targeting sequence from subunit VIII of human cytochrome c oxdase.
RDB13331 pONL-N1_Mito Orange Nano-lantern for labeling of mitochondria by the mitochondrial targeting sequence from subunit VIII of human cytochrome c oxdase.

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056054 IRAK140C06 pCMV-SPORT6 BC063025 NM_004074

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE045063 W01A112K23 pENTR-TOPO IRAK140C06 BC063025 NM_004074  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042907 ARe07E11 pKA1U5 NM_004074.2  
GTTTCCTGACCTTGGGCTACGGCTGACCGTTTTTTGTGGTGTACTCCGNTGCCATCATGT
HKR049371 ARe23H03 pKA1U5 NM_004074.2  
GCCTGACCTTGGGCTACGGCTGACCGTTTTTTGTGGTGTACTCCGTGCCATCATGTCCGT
HKR049751 ARe24G07 pKA1U5 NM_004074.2  
GGTTTTTTGTGGTGTACTCCGNTGCCATCATGTCCGTTCCTGACGCCGCTGCTGCTGCGG
HKR061276 ARe53D04 pKA1U5 NM_004074.2  
GAACTTCCGGCCAGCGCAGCCATTTTGGCTTCCTGACCTTGGGCTACGGCTGACCGTTTT
HKR066432 ARe66B08 pKA1U5 NM_004074.2  
ATCCTGATTTTGGCTTCCTGACCTTGGGCTACGGCTGACCGTTTTTTGTGGTGTACTCCG
HKR066475 ARe66D03 pKA1U5 NM_004074.2  
GAGCCAGCGCAGCCATTTTGGCTTCCTGACCTTGGGCTACGGCTGACCGTTTTTTGTGGT
HKR069345 ARe73G01 pKA1U5 NM_004074.2  
ATCCNGATCNCGGCTTCCTGACCTTGGGCAACCCCTTAANGTTNTTTGTGGTGATACCCC
HKR078802 ARe97A02 pKA1U5 NM_004074.2  
GGCTTCCCCAGCTCCAGAACTTCCGGCCAGCGCAGCCATTTTGGCTTCCTGACCTTGGGC
HKR162030 ARi05B06 pGCAP10 NM_004074.2  
GGCAGCCATTTTGGCTTCCTGACCTTGGGCTACGGCTGACCGTTTTTTGTGGTGTACTCC
HKR174500 ARi36E04 pGCAP10 NM_004074.2  
GAACTTCCGGCCAGCGCAGCCATTTTGGCTTCCTGACCTTGGGCTACGGCTGACCGTTTT
HKR203562 ARiS008P02 pGCAP10 NM_004074.2  
GCCAGAACTTCCGGCCAGCGCAGCCATTTTGGCTTCCTGACCTTGGGCTACGGCTGACCG
HKR219667 ARiS049C19 pGCAP10 NM_004074.2  
GACTTCCGGCCAGCGCAGCCATTTTGGCTTCCTGACCTTGGGCTACGGCTGACCGTTTTT
HKR219814 ARiS049I22 pGCAP10 NM_004074.2  
ATTTTTTGGCTTCCTGACCTTGGGCTACGGCTGACCGTTTTTTGTGGTGTACTCCGTGCC
HKR260158 ARiS150G14 pGCAP10 NM_004074.2  
GGTTTTTTGTGGTGTACTCCGTGCCATCATGTCCGTCCTGACGCCGCTGCTGCTGCGGGG
HKR277913 ARiS194N01 pGCAP10 NM_004074.2  
CGGCCGGCCGATGCCGGCCAGCGCAGCCATTTTGGCTTCCTGACCTTGGGCTACGGCTGA
HKR331625 RBb29B01 pGCAP1 NM_004074.2  
TGCCGGCCAGCGCAGCCATTTTGGCTTCCTGACCTTGGGCTACGGCTGACCGTTTTTTGT
HKR334425 RBb36B01 pGCAP1 NM_004074.2  
GCCCTGCTTCCCCAGCTCCAGAACTTCCGGCCAGCGCAGCCATTTTGGCTTCCTGACCTT
HKR361679 RBd04D07 pGCAP10 NM_004074.2  
GAGCTCCAGAACTTCCGGCCAGCGCAGCCATTTTGGCTTCCTGACCTTGGGCTACGGCTG
HKR361750 RBd04G06 pGCAP10 NM_004074.2  
GCCCTGCTTCCCCAGCTCCAGAACTTCCGGCCAGCGCAGCCATTTTGGCTTCCTGACCTT
HKR363251 RBd08C03 pGCAP10 NM_004074.2  
GGTTTTTTGTGGTGTACTCCGTGCCATCATGTCCGTCCTGACGCCGCTGCTGCTGCGGGG
HKR364980 RBd12H12 pGCAP10 NM_004074.2  
HKR374075 RBd35D03 pGCAP10 NM_004074.2  
GGGCCAGCGCAGCCATTTTGGCTTCCTGACCTTGGGCTACGGCTGACCGTTTTTTGTGGT
HKR375601 RBd39A01 pGCAP10 NM_004074.2  
TGGGCCATTTTGGCTTCCTGACCTTGGGCTACGGCTGACCGTTTTTTGTGGTGTACTCCG
HKR378169 RBd45H01 pGCAP10 NM_004074.2  
GGGCTTCCTGACCTTGGGCTACGGCTGACCGTTTTTTGTGGTGTACTCCGTGCCATCATG
HKR378805 RBd47A05 pGCAP10 NM_004074.2  
GAGCTCCAGAACTTCCGGCCAGCGCAGCCATTTTGGCTTCCTGACCTTGGGCTACGGCTG
HKR382174 RBd55H06 pGCAP10 NM_004074.2  
GACTTCCGGCCAGCGCAGCCATTTTGGCTTCCTGACCTTGGGCNNNNNNTGACCGTTTTT
HKR394856 RBd87C08 pGCAP10 NM_004074.2  
GATTTTGGCTTCCTGACCTTGGGCTACGGCTGACCGTTTTTTGTGGTGTACTCCGTGCCA
HKR398476 RBd96D04 pGCAP10 NM_004074.2  
GAGCTCCAGAACTTCCGGCCAGCGCAGCCATTTTGGCTTCCTGACCTTGGGCTACGGCTG
HKR432432 RBdS081B08 pGCAP10 NM_004074.2  
GATTTTGGCTTCCTGACCTTGGGCTACGGCTGACCGTTTTTTGTGGTGTACTCCGTGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl