Prev. |  KEGG KO K02272 > 

RIKEN DNA Bank Human Resource - COX7C

Gene ID NCBI Gene 1350 |  KEGG hsa:1350
Gene Symbol COX7C
Protein Name cytochrome c oxidase subunit 7C
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K02272) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080511 IRAL001E15 pOTB7 BC001005 NM_001867
HGY084088 IRAL010D16 pOTB7 BC007498 NM_001867 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR061257 ARe53C09 pKA1U5 NM_001867.2  
TGAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGTGCCGCC
HKR062408 ARe56A08 pKA1U5 NM_001867.2  
GGTCGTGAAAAAAAAGGTCTTGGTGAGGTGCCNCCNTTNCATCTGCTCCTCATTCTCTGC
HKR076049 ARe90C01 pKA1U5 NM_001867.2  
GCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGTG
HKR076129 ARe90F09 pKA1U5 NM_001867.2  
GCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGTG
HKR164051 ARi10C03 pGCAP10 NM_001867.2  
GCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGTG
HKR164455 ARi11C07 pGCAP10 NM_001867.2  
CTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGTGC
HKR166026 ARi15B02 pGCAP10 NM_001867.2  
CGGCCGGCCGATGGGTGAGGTGCCGCCATTTCATCTGTCCTCATTCTCTGCGCCTTTCGC
HKR176409 ARi41A09 pGCAP10 NM_001867.2  
GCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGTG
HKR177225 ARi43B01 pGCAP10 NM_001867.2  
GAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGTGCCGCCATTTCATCTGTCCTCATTCTCT
HKR179231 ARi48B07 pGCAP10 NM_001867.2  
TGCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGT
HKR181627 ARi54B03 pGCAP10 NM_001867.2  
GCCCATTTCCCATCTTTCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAA
HKR181723 ARi54F03 pGCAP10 NM_001867.2  
ATCTTTCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAGGTCTTGGTG
HKR188570 ARi71H02 pGCAP10 NM_001867.2  
GCATTTCCCATCTTTCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAG
HKR219763 ARiS049G19 pGCAP10 NM_001867.2  
GCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGTG
HKR235167 ARiS087P07 pGCAP10 NM_001867.2  
AAAAAAAAAGGTCTTGGTGAGGTGCCGCCATTTCATCTGTCCTCATTCTCTGCGCCTTTC
HKR260336 ARiS150N24 pGCAP10 NM_001867.2  
GCCTCATTCTCTGCGCCTTTCGCAGAGCTTCCAGCAGCGGTATGTTGGGCCAGAGCATCC
HKR279399 ARiS198I07 pGCAP10 NM_001867.2  
GAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGTGCCGCCA
HKR322969 RBb07H01 pKA1U5 NM_001867.2  
GGTGAAAAAAAAGGTCTTGGTGAGGTGCCGCCATTTCATCTGTCCTCATTCTCTGCGCCT
HKR332051 RBb30C03 pGCAP1 NM_001867.2  
GCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGTG
HKR333745 RBb34G01 pGCAP1 NM_001867.2  
AAAAAGGTCTTGGTGAGGTGCCGCCATTTCATCTGTCCTCATTCTCTGCGCCTTTCGCAG
HKR337603 RBb44A03 pGCAP1 NM_001867.2  
TGGTCGTGAAAAAAAAGGTCTTGGTGAGGTGCCGCCATTTCATCTGTCCTCATTCTCTGC
HKR338031 RBb45B07 pGCAP1 NM_001867.2  
GCCCATTTCCCATCTTTCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAA
HKR346898 RBb67E02 pGCAP1 NM_001867.2  
GCCCATTTCCCATCTTTCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAA
HKR347225 RBb68B01 pGCAP1 NM_001867.2  
AAATGTGGTGAAAAAAAAGGTCTTGGTGAAGGTGCCGCCATTCATCTGTCCTCATTCTCT
HKR362129 RBd05F09 pGCAP10 NM_001867.2  
GCGTGAAAAAAAAGGTCTTGGTGAGGTGCCGCCATTTCATCTGTCCTCATTCTCTGCGCC
HKR373211 RBd33A11 pGCAP10 NM_001867.2  
GCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAAGGTCTTGGTGAGGT
HKR377371 RBd43H03 pGCAP10 NM_001867.2  
GATTTTCCCATCTTTCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAG
HKR379772 RBd49H04 pGCAP10 NM_001867.2  
GGCGCACCGGGGAACAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGTGCCGCCATTTCATC
HKR383701 RBd59E05 pGCAP10 NM_001867.2  
GACCGGGGAACAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGTGCCGCCATTTCATCTGTC
HKR384028 RBd60B04 pGCAP10 NM_001867.2  
ATTTTTCCCATCTTTCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAG
HKR384076 RBd60D04 pGCAP10 NM_001867.2  
GATTTTCCCATCTTTCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAG
HKR384930 RBd62F10 pGCAP10 NM_001867.2  
GGTCGTGAAAAAAAAGGTCTTGGTGAGGTGCCGCCATTTCATCTGTCCTCATTCTCTGCG
HKR386180 RBd65H12 pGCAP10 NM_001867.2  
GCCATTTCCCATCTTTCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAA
HKR394954 RBd87G10 pGCAP10 NM_001867.2  
GATTTCCCATCTTTCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAGG
HKR395346 RBd88G02 pGCAP10 NM_001867.2  
GAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGTGCCGCCATTTCATCTGTCCTCATTCTCT
HKR405882 RBdS014L18 pGCAP10 NM_001867.2  
TTTTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGT
HKR405933 RBdS014N21 pGCAP10 NM_001867.2  
GAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGTGCCGCCATTTCATCTGTCCTCATTCTCT
HKR420693 RBdS051M05 pGCAP10 NM_001867.2  
GCTTTCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAGGTCTTGGTGA
HKR461772 RBdS154H04 pGCAP10 NM_001867.2  
GCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl