Prev. |  KEGG KO K02270 > 

RIKEN DNA Bank Human Resource - COX7A2

Gene ID NCBI Gene 1347 |  KEGG hsa:1347
Gene Symbol COX7A2
Protein Name cytochrome c oxidase subunit 7A2
Synonyms COX7AL|COX7AL1|COXVIIAL|COXVIIa-L|VIIAL
Ortholog resources KEGG ortholog (KEGG orthology K02270) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062532 ARe56F12 pKA1U5 NM_001865.2  
GAGTTCCGGCTTCCGGCGTGGCCATTTTCGTTGCCNGTTTNAGTCAGCTTGTGGCGGTTG
HKR072501 ARe81E05 pKA1U5 NM_001865.2  
TTTTTCGTTGGTGGTGTTCAGTTGTGGCGGTTGCTGGTCAGTAACAGCCAAGATGCTGCG
HKR168054 ARi20C06 pGCAP10 NM_001865.2  
GGCTCTTCGTCAGATTGGGCAGAGGACGATAAGCACTGCTTCCCGCAGGCATTTTAAAAA
HKR184152 ARi60G08 pGCAP10 NM_001865.2  
GGCCATTTTCGTTGGTGGTGTTCAGTTGTGGCGGTTGCTGGTCAGTAACAGCCAAGATGC
HKR208007 ARiS020A07 pGCAP10 NM_001865.2  
GGTGGCCATTTTCGTTGGTGGTGTTCAGTTGTGGCGGTTGCTGGTCAGTAACAGCCAAGA
HKR243787 ARiS109H19 pGCAP10 NM_001865.2  
GGCGGTTGCTGGTCAGTAACAGCCAAGATGCTGCGGAATCTGCTGGCTCTTCGTCAGATT
HKR326401 RBb16A01 pKA1U5 NM_001865.2  
GGTTGGTGGTGTTCAGTTGTGGCGGTTGCTNCCTCNGATAACAGCCAAGATGCTGCGGAA
HKR329356 RBb23G12 pGCAP1 NM_001865.2  
HKR329380 RBb23H12 pGCAP1 NM_001865.2  
GCCGGTTCCGGCGTGGCCATTTTCGTTGGTGGTGTTCAGTTGTGGCGGTTGCTGGTCAGT
HKR329770 RBb24H02 pGCAP1 NM_001865.2  
ATTTTCGTTGGTGGTGTTCAGTTGTGGCGGTTGCTGGTCAGTAACAGCCAAGATGCTGCG
HKR329780 RBb24H12 pGCAP1 NM_001865.2  
GCCGGTTCCGGCGNGGCCATTTTCGTTGCGTGGNGTTCACCTTTTGGCGGTTGCNGGTCA
HKR332499 RBb31E03 pGCAP1 NM_001865.2  
AAGAGTTCCGGTTCCGGCGTGGCCATTTTCGTTGGTGGTGTTCAGTTGTGGCGGTTGCTG
HKR332929 RBb32F09 pGCAP1 NM_001865.2  
GGTGGCGGTTGCTGGTCAGTAACAGCCAAGATGCTGCGGAATCTGCTGGCTCTTCGTCAG
HKR335652 RBb39C04 pGCAP1 NM_001865.2  
GCGGTTCCGGCGTGGCCATTTTCGTTGGTGGTGTTCAGTTGTGGCGGTTGCTGGTCAGTA
HKR338922 RBb47F02 pGCAP1 NM_001865.2  
GTCCGGCGTGGCCATTTTCGTTGGTGGTGTTCAGATTGTGGCGGTTGCTGGTCAGTAACA
HKR340145 RBb50G01 pGCAP1 NM_001865.2  
GAGTTGTGGCGGTTGCTGGTCAGTTAACAGCCAAGATGCTGCGGAATCTGCTGGCTCTTC
HKR341283 RBb53D11 pGCAP1 NM_001865.2  
TGTCCGGCGTGGCCATTTTCGTTGGTGGTGTTCAGTTGTGGCGGTTGCTGGTCAGTAACA
HKR362545 RBd06G01 pGCAP10 NM_001865.2  
GGGTAGTTCCGGTTCCGGCGTGGCCATTTTCGTTGGTGGTGTTCAGTTGTGGCGGTTGCT
HKR365377 RBd13H09 pGCAP10 NM_001865.2  
GGTGGCCATTTTCGTTGGTGGTGTTCAGTTGTGGCGGTTGCTGGTCAGTAACAGCCAAGA
HKR370006 RBd25A06 pGCAP10 NM_001865.2  
GGGTTCCGGCGTGGCCATTTTCGTTGGTGGTGTTCAGTTGTGGCGGTTGCTGGTCAGTAA
HKR388879 RBd72D07 pGCAP10 NM_001865.2  
GCCGGTTCCGGCGTGGCCATTTTCGTTGGTGGTGTTCAGTTGTGGCGGTTGCTGGTCAGT
HKR390481 RBd76D09 pGCAP10 NM_001865.2  
HKR394005 RBd85A05 pGCAP10 NM_001865.2  
GAGTTCCGGTTCCGGCGTGGCCATTTTCGTTGGTGGTGTTCAGTTGTGGCGGTTGCTGGT
HKR405212 RBdS013A12 pGCAP10 NM_001865.2  
GATTTTTCGTTGGTGGTGTTCAGTTGTGGCGGTTGCTGGTCAGTAACAGCCAAGATGCTG
HKR408942 RBdS022F22 pGCAP10 NM_001865.2  
GGGTTCCGGCGTGGCCATTTTCGTTGGTGGTGTTCAGTTGTGGCGGTTGCTGGTCAGTAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl