Prev. |  KEGG KO K02268 > 

RIKEN DNA Bank Human Resource - COX6C

Gene ID NCBI Gene 1345 |  KEGG hsa:1345
Gene Symbol COX6C
Protein Name cytochrome c oxidase subunit 6C
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K02268) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082451 IRAL006C03 pOTB7 BC000187 NM_004374 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043756 ARe09G12 pKA1U5 NM_004374.2  
GAGGAAGGACGTTGGTGTTGAGGTTAGCATACGCTATCAAGGACAGTAACTACCATGGCT
HKR057699 ARe44E03 pKA1U5 NM_004374.2  
GACGGTTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATACGTATCA
HKR074180 ARe85H12 pKA1U5 NM_004374.2  
AGCACGGTTCGTTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATACGTA
HKR079769 ARe99H01 pKA1U5 NM_004374.2  
TCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATACGTATCAAGGACA
HKR168172 ARi20H04 pGCAP10 NM_004374.2  
GGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTANCATACGTATCAAGGACAG
HKR170879 ARi27D07 pGCAP10 NM_004374.2  
GACGGTTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATACGTATCA
HKR219918 ARiS049N06 pGCAP10 NM_004374.2  
GACTCTTATTCTGCGCCTGCGCGCGGCTACAGCACGGTTCGTTTTTCCTTTAGTCAGGAA
HKR222101 ARiS055E05 pGCAP10 NM_004374.2  
GACGGTTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATACGTATCA
HKR279512 ARiS198M24 pGCAP10 NM_004374.2  
GACGGTTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATACGTATCA
HKR320553 RBb01G09 pKA1U5 NM_004374.2  
GACGGTTCGTTTTTCCTTTAGTCAGGAAGGACCTTNGTGTTGAGGTTAGCATACGTATCA
HKR321684 RBb04D12 pKA1U5 NM_004374.2  
GCTTTTTTTTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATACGTATCAAGGACAG
HKR322876 RBb07D04 pKA1U5 NM_004374.2  
AAAGTTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATACGTATCAA
HKR330081 RBb25D09 pGCAP1 NM_004374.2  
GACAGCACGGNTTCGTTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATA
HKR330523 RBb26F03 pGCAP1 NM_004374.2  
GACAGCACGGNTTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATAC
HKR336010 RBb40A10 pGCAP1 NM_004374.2  
GTACAGCACGGNTTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATA
HKR340949 RBb52G05 pGCAP1 NM_004374.2  
GGTCAGGAAGGACGTTGGTGTTTGAGGTTAGCATACGTATCAAGGACAGTAACTACCATG
HKR341745 RBb54G01 pGCAP1 NM_004374.2  
ACAGCACGGTTTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATACG
HKR343676 RBb59D04 pGCAP1 NM_004374.2  
AGCACGGTTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATACGTAT
HKR347681 RBb69D09 pGCAP1 NM_004374.2  
GACTCTTATTCTGCGCCTGCGCGCGGCTACAGCACGGTTCGTTTTTCCTTTAGTCAGGAA
HKR363353 RBd08G09 pGCAP10 NM_004374.2  
GACAGCACGGTTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATACG
HKR366955 RBd17G11 pGCAP10 NM_004374.2  
GTACAGCACGGTTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATAC
HKR367300 RBd18E04 pGCAP10 NM_004374.2  
GACGGTTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATACGTATCA
HKR377706 RBd44E10 pGCAP10 NM_004374.2  
GGCACTCTTATTCTGCGCCTGCGCGCGGCTACAGCACGGTTCGTTTTTCCTTTAGTCAGG
HKR382450 RBd56C02 pGCAP10 NM_004374.2  
GGGTTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATACGTATCAAG
HKR387656 RBd69C08 pGCAP10 NM_004374.2  
GGGTGTTGAGGTTAGCATACGTATCAAGGACAGTAACTACCATGGCTCCCGAAGTTTTGC
HKR393353 RBd83G09 pGCAP10 NM_004374.2  
GTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATACGTATCAAGGAC
HKR420650 RBdS051K10 pGCAP10 NM_004374.2  
GACGGTTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATACGTATCA
HKR433427 RBdS083J11 pGCAP10 NM_004374.2  
GACGGTTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATACGTATCA
HKR453011 RBdS132I19 pGCAP10 NM_004374.2  
GCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATACGTATCAAGGACAGTAACTAC
HKR461631 RBdS154B07 pGCAP10 NM_004374.2  
GAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATACGTATCAAGGACAGTAACTACCATG
HKR462483 RBdS156D11 pGCAP10 NM_004374.2  
GGGTTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGGTTAGCATACGTATCAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl