Prev. |  KEGG KO K02266 > 

RIKEN DNA Bank Human Resource - COX6A1

Gene ID NCBI Gene 1337 |  KEGG hsa:1337
Gene Symbol COX6A1
Protein Name cytochrome c oxidase subunit 6A1
Synonyms CMTRID|COX6A|COX6AL
Ortholog resources KEGG ortholog (KEGG orthology K02266) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087112 IRAL017M24 pOTB7 BC007723 NM_004373 Full
HGY103073 IRAL057L09 pDNR-LIB BC070186 NM_004373 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098819 M01C047A19 pDONR221 MGC13-A10 BC007723 NM_004373  
HGE098867 M01C047C19 pDONR221 MGC13-A10 BC007723 NM_004373  
HGE098915 M01C047E19 pDONR221 MGC13-A10 BC007723 NM_004373  
HGE098963 M01C047G19 pDONR221 MGC13-A10 BC007723 NM_004373  
HGE099011 M01C047I19 pDONR221 MGC13-A10 BC007723 NM_004373  
HGE099059 M01C047K19 pDONR221 MGC13-A10 BC007723 NM_004373  
HGE099107 M01C047M19 pDONR221 MGC13-A10 BC007723 NM_004373  
HGE099155 M01C047O19 pDONR221 MGC13-A10 BC007723 NM_004373  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044550 ARe11G06 pKA1U5 NM_004373.2  
GAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGGTCCCG
HKR056121 ARe40F01 pKA1U5 NM_004373.2  
GAGTCCAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGG
HKR064523 ARe61F03 pKA1U5 NM_004373.2  
TGGAGATCAAAAATGGCGGTAGTTGGTGTGTCCCCTTTNAANNTCGGCTGCTGGGTCGGTC
HKR064906 ARe62E10 pKA1U5 NM_004373.2  
GAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGGTCCCG
HKR073280 ARe83D08 pKA1U5 NM_004373.2  
GAGTCCAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGG
HKR073378 ARe83H10 pKA1U5 NM_004373.2  
GAGTCCAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGG
HKR079207 ARe98A07 pKA1U5 NM_004373.2  
TGAGTTCCAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTC
HKR166053 ARi15C05 pGCAP10 NM_004373.2  
GAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGGTCCCG
HKR219682 ARiS049D10 pGCAP10 NM_004373.2  
GAGTCCAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGG
HKR234225 ARiS085J09 pGCAP10 NM_004373.2  
GGGCGCTGCGGCAGTCCAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGC
HKR234372 ARiS085P12 pGCAP10 NM_004373.2  
GAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGGTCCCG
HKR277738 ARiS194F18 pGCAP10 NM_004373.2  
GAGTCCAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGG
HKR338948 RBb47G04 pGCAP1 NM_004373.2  
TGAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGGTCCC
HKR347347 RBb68G03 pGCAP1 NM_004373.2  
GAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGGTCCCG
HKR360474 RBd01D02 pGCAP10 NM_004373.2  
GAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGGTCCCG
HKR362108 RBd05E12 pGCAP10 NM_004373.2  
TGAGTCCAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCG
HKR363756 RBd09G12 pGCAP10 NM_004373.2  
GAGTCCAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGG
HKR365321 RBd13F01 pGCAP10 NM_004373.2  
GAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGGTCCCG
HKR372451 RBd31C03 pGCAP10 NM_004373.2  
GAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGGTCCCG
HKR376858 RBd42C10 pGCAP10 NM_004373.2  
GAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGGTCCCG
HKR389306 RBd73E10 pGCAP10 NM_004373.2  
GAGATCNAAAATGGNGGTANTTGGNGNGTCCTCGGTTTCTCGGCTGCTGGGTCGGTCCCG
HKR403013 RBdS007I21 pGCAP10 NM_004373.2  
ACTTCCGCTTCCGGCGCTGCGGCAGTCCAGATCAAAAATGGCGGTAGTTGGTGTGTCCTC
HKR406284 RBdS015L20 pGCAP10 NM_004373.2  
GAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGGTCCCG
HKR408971 RBdS022H03 pGCAP10 NM_004373.2  
GGGTTTCTCGGCTGCTGGGTCGGTCCCGCCCACAGCTGGGGCGGCCTATGTCGAGTGGCG
HKR433307 RBdS083E11 pGCAP10 NM_004373.2  
GAGTCCAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGG
HKR462524 RBdS156F04 pGCAP10 NM_004373.2  
GAGTCCAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl