Prev. |  KEGG KO K02265 > 

RIKEN DNA Bank Human Resource - COX5B

Gene ID NCBI Gene 1329 |  KEGG hsa:1329
Gene Symbol COX5B
Protein Name cytochrome c oxidase subunit 5B
Synonyms COXVB
Ortholog resources KEGG ortholog (KEGG orthology K02265) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086002 IRAL015A02 pOTB7 BC006229 NM_001862

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098429 M01C046B05 pDONR221 MGC12-G03 BC006229 NM_001862  
HGE098477 M01C046D05 pDONR221 MGC12-G03 BC006229 NM_001862  
HGE098525 M01C046F05 pDONR221 MGC12-G03 BC006229 NM_001862  
HGE098573 M01C046H05 pDONR221 MGC12-G03 BC006229 NM_001862  
HGE098621 M01C046J05 pDONR221 MGC12-G03 BC006229 NM_001862  
HGE098669 M01C046L05 pDONR221 MGC12-G03 BC006229 NM_001862  
HGE098717 M01C046N05 pDONR221 MGC12-G03 BC006229 NM_001862  
HGE098765 M01C046P05 pDONR221 MGC12-G03 BC006229 NM_001862  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066547 ARe66G03 pKA1U5 NM_001862.2  
TGGCTGCTAGTCGCGGACGCAATGGCTTCAAGGCTTACTTCGCGGAGCTGGAACGCTGGC
HKR078523 ARe96F03 pKA1U5 NM_001862.2  
AGTTTTGCTGCTAGTCGCGGACGCAATGGCTTCAAGGTTACTTCGCGGAGCTGGAACGCT
HKR079297 ARe98E01 pKA1U5 NM_001862.2  
GGCAGCTTGTTCCCGGAAGTTTTGCTGCTAGTCGCGGACGCAATGGCTTCAAGGTTACTT
HKR080427 ARf01B03 pKA1U5 NM_001862.2  
GGCGGACGCAATGGCTTCAAGGTTACTTCGCGGAGCTGGAACGCTGGCCGCGCAGGCCCT
HKR205545 ARiS013O09 pGCAP10 NM_001862.2  
GGCTAGTCGCGGACGCNATGGCTTCAAGGTTACTTCGCGGAGCTGGAACGCTGGCCGCGC
HKR248909 ARiS122E13 pGCAP10 NM_001862.2  
TGAAGTTTTGCTGCTAGTCGCGGACGCAATGGCTTCAAGGTTACTTCGCGGAGCTGGAAC
HKR279380 ARiS198H12 pGCAP10 NM_001862.2  
GGCTAGTCGCGGACGCAATGGCTTCAAGGTTACTTCGCGGAGCTGGAACGCTGGCCGCGC
HKR331627 RBb29B03 pGCAP1 NM_001862.2  
GCGGGCGGACGCAATGGCTTCAAGGTTTACTTCGCGGAGCTGGAACGCTGGCCGCGCAGG
HKR341302 RBb53E06 pGCAP1 NM_001862.2  
HKR341654 RBb54C06 pGCAP1 NM_001862.2  
TGGGCTGCTAGTCGCGGACGCAATGGCTTCAAGGTTACTTCGCGGAGCTGGAACGCTGGC
HKR348473 RBb71D01 pGCAP1 NM_001862.2  
TGGGCTGCTAGTCGCGGACGCAATGGCTTCAAGGTTACTTCGCGGAGCTGGAACGCTGGC
HKR372951 RBd32G07 pGCAP10 NM_001862.2  
GGCTAGTCGCGGACGCAATGGCTTCAAGGTTACTTCGCGGAGCTGGAACGCTGGCCGCGC
HKR375749 RBd39G05 pGCAP10 NM_001862.2  
GGCGGACGCAATGGCTTCAAGGTTACTTCGCGGAGCTGGAACGCTGGCCGCGCAGGCCCT
HKR383236 RBd58B12 pGCAP10 NM_001862.2  
GGCTAGTCGCGGACGCAATGGCTTCAAGGTTACTTCGCGGAGCTGGAACGCTGGCCGCGC
HKR384148 RBd60G04 pGCAP10 NM_001862.2  
GAGCTTGTTCCCGGAAGTTTTGCTGCTAGTCGCGGACGCAATGGCTTCAAGGTTACTTCG
HKR396175 RBd90H07 pGCAP10 NM_001862.2  
GAGTCGCGGACGCAATGGCTTCAAGGTTACTTCGCGGAGCTGGAACGCTGGCCGCGCAGG
HKR399283 RBd98D11 pGCAP10 NM_001862.2  
GGTTTTGCTGCTAGTCGCGGACGCAATGGCTTCAAGGTTACTTCGCGGAGCTGGAACGCT
HKR403020 RBdS007J04 pGCAP10 NM_001862.2  
GGCTGCTAGTCGCGGACGCAATGGCTTCAAGGTTACTTCGCGGAGCTGGAACGCTGGCCG
HKR406343 RBdS015O07 pGCAP10 NM_001862.2  
GGCTAGTCGCGGACGCAATGGCTTCAAGGTTACTTCGCGGAGCTGGAACGCTGGCCGCGC
HKR444276 RBdS110L12 pGCAP10 NM_001862.2  
GGCTAGTCGCGGACGCAATGGCTTCAAGGTTACTTCGCGGAGCTGGAACGCTGGCCGCGC
HKR444306 RBdS110M18 pGCAP10 NM_001862.2  
CGGCCGGCCGATGCCCGGAAGTTTTGCTGCTAGTCGCGGACGCAATGGCTTCAAGGTTAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl