Prev. |  KEGG KO K04415 > 

RIKEN DNA Bank Human Resource - MAP3K8

Gene ID NCBI Gene 1326 |  KEGG hsa:1326
Gene Symbol MAP3K8
Protein Name mitogen-activated protein kinase kinase kinase 8
Synonyms AURA2|COT|EST|ESTF|MEKK8|TPL2|Tpl-2|c-COT
Featured content MAP kinases (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content T cell receptor signaling pathway (human)
Ortholog resource in our bank

  MAP3K8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053777 ARe34H09 pKA1U5 NM_001320961.2 full done
GACTCGTCCGCTCCGCTCTGGACTGCGCGCCACGCTTCTGGGGTCCGGCGCCCTGGTTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl