Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MAP3K8

Gene ID (NCBI) 1326
Gene Symbol MAP3K8
Protein Name mitogen-activated protein kinase kinase kinase 8
Synonyms AURA2|COT|EST|ESTF|MEKK8|TPL2|Tpl-2|c-COT
Databases KEGG hsa:1326 |  NCBI Gene 1326
Featured content MAP kinases (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content T cell receptor signaling pathway (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K04415)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR053777 ARe34H09 pKA1U5 NM_005204.2  
GACTCGTCCGCTCCGCTCTGGACTGCGCGCCACGCTTCTGGGGTCCGGCGCCCTGGTTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl