Prev. |  KEGG KO K00545 > 

RIKEN DNA Bank Human Resource - COMT

Gene ID NCBI Gene 1312 |  KEGG hsa:1312
Gene Symbol COMT
Protein Name catechol-O-methyltransferase
Synonyms HEL-S-98n
Ortholog resource in our bank

  COMT

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080742 IRAL001O06 pOTB7 BC000419 NM_007310 Full/var
HGY084191 IRAL010H23 pOTB7 BC005867 NM_007310 Full/var
HGY091240 IRAL028B16 pOTB7 BC011935 NM_007310 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE040131 W01A100F11 pENTR-TOPO IRAL001O06 BC005867 NM_007310  
HGE040133 W01A100F13 pENTR-TOPO IRAL001O06 BC005867 NM_007310  
HGE040135 W01A100F15 pENTR-TOPO IRAL001O06 BC005867 NM_007310  
HGE040141 W01A100F21 pENTR-TOPO IRAL001O06 BC005867 NM_007310  
HGE051114 W01A127N02 pENTR-TOPO IRAL001O06 BC005867 NM_007310  
HGE051116 W01A127N04 pENTR-TOPO IRAL001O06 BC005867 NM_007310  
HGE051124 W01A127N12 pENTR-TOPO IRAL001O06 BC005867 NM_007310  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR049723 ARe24F03 pKA1U5 NM_000754.2  
GAGGGCTGCCCGCCGCGCTGCCTGCGCCGGACCGGGGCGGGTCCAGTCCCGGGCGGGCCG
HKR162450 ARi06C02 pGCAP10 NM_000754.2  
TGGGGCGGGCCGTCGCGGGAGAGAAATAACATCTGCTTTGCTGCCGAGCTCAGAGGAGAC
HKR234171 ARiS085H03 pGCAP10 NM_000754.2  
GAGTCCCGGGCGGGCCGTCGCGGGAGAGAGATGAGAGATCGTAGAAATAAAGACACAAGA
HKR336434 RBb41B10 pGCAP1 NM_000754.2  
GCCCCGCAGCGCCACCGCCATTGCCGCCATCGTCGTTGGGGCTTCTGGGGCAGCTAGGGC
HKR387697 RBd69E01 pGCAP10 NM_000754.2  
GTAATCCCCGCAGCGCCACCGCCATTGCCGCCATCGTCGTGGGGCTTCTGGGGCAGCTAG
HKR470850 RBdS177C02 pGCAP10 NM_000754.2  
GGTGGGGCTTCTGGGGCAGCTAGGGCTGCCCGCCGCGCTGCCTGCGCCGGACCGGGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl