Prev. | 

RIKEN DNA Bank Human Resource - COL8A1

Gene ID NCBI Gene 1295 |  KEGG hsa:1295
Gene Symbol COL8A1
Protein Name collagen type VIII alpha 1 chain
Synonyms C3orf7
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005608 IRAK014A08 pCMV-SPORT6 BC013581 NM_020351 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092017 M01C030A17 pDONR221 MGC04-E09 BC013581 NM_020351  
HGE092065 M01C030C17 pDONR221 MGC04-E09 BC013581 NM_020351  
HGE092113 M01C030E17 pDONR221 MGC04-E09 BC013581 NM_020351  
HGE092161 M01C030G17 pDONR221 MGC04-E09 BC013581 NM_020351  
HGE092209 M01C030I17 pDONR221 MGC04-E09 BC013581 NM_020351  
HGE092257 M01C030K17 pDONR221 MGC04-E09 BC013581 NM_020351  
HGE092305 M01C030M17 pDONR221 MGC04-E09 BC013581 NM_020351  
HGE092353 M01C030O17 pDONR221 MGC04-E09 BC013581 NM_020351  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066132 ARe65F12 pKA1U5 NM_001850.3  
GGGATCACAGCCCTTCCCCGATCCTCTCCGTGGGAGCCAGCGAGCCTCTCTCCCTGATCT
HKR068882 ARe72D10 pKA1U5 NM_001850.3  
GGGATCACAGCCCTTCCCCGATCCTCTCCGTGGGAGCCAGCGAGCCTCTCTCCCTGATCT
HKR209376 ARiS023H08 pGCAP10 NM_001850.3  
GGGATCACAGCCCTTCCCCGATCCTCTCCGTGGGAGCCAGCGAGCCTCTCTCCCTGATCT
HKR219674 ARiS049D02 pGCAP10 NM_001850.3  
GGGATCACAGCCCTTCCCCGATCCTCTCCGTGGGAGCCAGCGAGCCTCTCTCCCTGATCT
HKR260034 ARiS150B10 pGCAP10 NM_001850.3  
GGGATCACAGCCCTTCCCCNATCCTCTCCGTGGGAGCCAGCGAGCCTCTCTCCCTGATCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl