Prev. |  KEGG KO K19721 > 

RIKEN DNA Bank Human Resource - COL5A1

Gene ID NCBI Gene 1289 |  KEGG hsa:1289
Gene Symbol COL5A1
Protein Name collagen type V alpha 1 chain
Synonyms EDSC|EDSCL1
Ortholog resources KEGG ortholog (KEGG orthology K19721) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR071631 ARe79B07 pKA1U5 NM_000093.3 done
GCCGCACGTCTCCGTTCCCCGCGGCTGGCGCACGACCTCACTCATAGCGGAGCGCCCACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl