Prev. |  KEGG KO K06759 > 

RIKEN DNA Bank Human Resource - CNTN1

Gene ID NCBI Gene 1272 |  KEGG hsa:1272
Gene Symbol CNTN1
Protein Name contactin 1
Synonyms F3|GP135|MYPCN
Ortholog resources KEGG ortholog (KEGG orthology K06759) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR248857 ARiS122C09 pGCAP10 NM_001843.2  
GACATTTTCNTTTCAGGCCCTCCAGGCCCTCCAGGTGGTCTGAGAATAGAAGACATTAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl