Prev. |  KEGG KO K01121 > 

RIKEN DNA Bank Human Resource - CNP

Gene ID NCBI Gene 1267 |  KEGG hsa:1267
Gene Symbol CNP
Protein Name 2',3'-cyclic nucleotide 3' phosphodiesterase
Synonyms CNP1
Ortholog resources KEGG ortholog (KEGG orthology K01121) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005006 IRAK012I14 pCMV-SPORT6 BC011046 NM_033133 Full
HGX025145 IRAK062O09 pCMV-SPORT6 BC028040 NM_033133 Full
HGY042430 IRAK106B06 pBluescript BC045561 NM_033133 Partial/var
HGY081655 IRAL004C07 pOTB7 BC001362 NM_033133 Full
HGY086989 IRAL017H21 pOTB7 BC006392 NM_033133 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR388132 RBd70F12 pGCAP10 NM_033133.4  
GAGGCGGGCGGCCCCGGAGCGCTGGTGCCGGCAGAGGCGGCGACGGTGGCGCCCCTCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl