Prev. | 

RIKEN DNA Bank Human Resource - CNN3

Gene ID NCBI Gene 1266 |  KEGG hsa:1266
Gene Symbol CNN3
Protein Name calponin 3
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082881 IRAL007D09 pOTB7 BC025372 NM_001839 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041659 ARe04C11 pKA1U5 NM_001839.3  
GAGCCGGGTGCTTCGCAGCGGAGCTCGAGGCTCTGTAGCACCCAGGTTGGACCCAGTCGC
HKR057304 ARe43E08 pKA1U5 NM_001839.3  
GGCCCTTAGGCGGAGCCCGTCTGCGCGGCCAGGGTACCCGGCGAGCCGCTGCCGCAGCCC
HKR063201 ARe58A01 pKA1U5 NM_001839.3  
GGTGCTTCGCAGCGGTAGCTCGAGGCTCTGCTANCACCCAGATTGGACCCAGGTCGCCCA
HKR068456 ARe71C08 pKA1U5 NM_001839.3  
GAGGCTCTGTAGCACCCAGTTGGACCCAGTCGCCCAGGCACCGCCCGCGCCCCACGGCCG
HKR078148 ARe95G04 pKA1U5 NM_001839.3  
GGGGTGCTTCGCAGCGGAGCTCGAGGCTCTGTAGCACCCAGNTTGGACCCAGNTCGCCCA
HKR164545 ARi11G01 pGCAP10 NM_001839.3  
TGGTGCGGGCGGCGAGCGAGGCAGCCGGGTGCTTCGCAGCGGAGCTCGAGGCTCTGTAGC
HKR167260 ARi18C12 pGCAP10 NM_001839.3  
GGAGGTGCGGGCGGCGAGCGAGGCAGCCGGGTGCTTCGCAGCGGAGCTCGAGGCTCTGTA
HKR172052 ARi30C04 pGCAP10 NM_001839.3  
GGGGGAACCGAGGTGCGGGCGGCGAGCGAGGCAGCCGGGTGCTTCGCAGCGGAGCTCGAG
HKR172459 ARi31C11 pGCAP10 NM_001839.3  
GGCGGGCGGCGAGCGAGGCAGCCGGGTGCTTCGCAGCGGAGCTCGAGGCTCTGTAGCACC
HKR172932 ARi32F12 pGCAP10 NM_001839.3  
TGGCGGGCGGCGAGCGAGGCAGCCGGGTGCTTCGCAGCGGAGCTCGAGGCTCTGTAGCAC
HKR180831 ARi52B07 pGCAP10 NM_001839.3  
TGGAGGTGCGGGCGGCGAGCGAGGCAGCCGGGTGCTTCGCAGCGGAGCTCGAGGCTCTGT
HKR182177 ARi55H09 pGCAP10 NM_001839.3  
GGAGCGAGGCAGCCGGGTGCTTCGCAGCGGAGCTCGAGGCTCTGTAGCACCCAGTTGGAC
HKR184555 ARi61G11 pGCAP10 NM_001839.3  
GATTAACCTCCCGGGAGCCCAAGCATGTCAGGATTGCCACCGCACCGTCCGACCGCTGGT
HKR187260 ARi68C12 pGCAP10 NM_001839.3  
HKR235488 ARiS088L24 pGCAP10 NM_001839.3  
GGGGTGCTTCGCAGCGGAGCTCGAGGCTCTGTAGCACCCAGTTGGACCCAGTCGCCCAGG
HKR264688 ARiS161L24 pGCAP10 NM_001839.3  
GAGCCGGGTGCTTCGCAGCGGAGCTCGAGGCTCTGTAGCACCCAGTTGGACCCAGTCGCC
HKR399651 RBd99C03 pGCAP10 NM_001839.3  
GAGCCGGGTGCTTCGCAGCGGAGCTCGAGGCTCTGTAGCACCCAGTTGGACCCAGTCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl