Prev. | 

RIKEN DNA Bank Human Resource - CNN2

Gene ID NCBI Gene 1265 |  KEGG hsa:1265
Gene Symbol CNN2
Protein Name calponin 2
Synonyms -
Links

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04685 pAxCALNLhCNN2(reverse) Shuttle vector to generate rAd expressing human CNN2
RDB04689 pAxCALNLhCNN2(forward) Shuttle vector to generate rAd expressing human CNN2
RDB04696 pAxCALNLhCNN2(reverse) Shuttle vector to generate rAd expressing human CNN2
RDB04697 pAxCALNLhCNN2(forward) Shuttle vector to generate rAd expressing human CNN2
RDB05102 pAxCALNLhCNN2(forward) Shuttle vector to generate rAd expressing human CNN2
RDB05260 pAxCALNLhCNN2(forward) Shuttle vector to generate rAd expressing human CNN2

RDB_org_190226.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR063299 ARe58E03 pKA1U5 NM_004368.2  
GCTGTGCGGCCCCGNTCCCGCCGCCCGCCCGCCAGCCATGAGCTCCACGCAGTTCAACAA
HKR070450 ARe76C02 pKA1U5 NM_004368.2  
GCCCGTCCCGNTCCCGNTCCTGTGCGGCCCCGATCCCGCNGCCCGCCCGCCAGCCATGAG
HKR248899 ARiS122E03 pGCAP10 NM_004368.2  
GCCCCCGCCGCCCGCCCGCCAGCCATGAGCTCCACGCAGTTCAACAAGGGCCCCTCGTAC
HKR369652 RBd24C04 pGCAP10 NM_004368.2  
GGGCCCCGTCCCGCCGCCCGCCCGCCAGCCATGAGCTCCACGCAGTTCAACAAGGGCCCC
HKR376050 RBd40C02 pGCAP10 NM_004368.2  
TGGAGCCCGGCGGTCCCGTCCCGTCCCGTCCTGTGCGGCCCCGTCCCGCCGCCCGCCCGC
HKR377307 RBd43E11 pGCAP10 NM_004368.2  
GAGCCATGAGCTCCACGCAGTTCAACAAGGGCCCCTCGTACGGGCTGTCGGCCGAGGTCA
HKR461789 RBdS154H21 pGCAP10 NM_004368.2  
TTTTTTTTTTTCTTAACCCGTTCAGTGCTGCCAGTCAACCAAGGGTCTGTGAGTGTCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl