Prev. |  KEGG KO K04644 > 

RIKEN DNA Bank Human Resource - CLTA

Gene ID NCBI Gene 1211 |  KEGG hsa:1211
Gene Symbol CLTA
Protein Name clathrin light chain A
Synonyms LCA
Featured content Endocytosis (human)
Featured content Lysosome (human)
Featured content Huntington disease - human
Ortholog resource in our bank

  CLTA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083952 IRAL009O16 pOTB7 BC019287 NM_001833 Full
HGY090166 IRAL025G22 pOTB7 BC009201 NM_001833 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097630 M01C044B06 pDONR221 MGC11-H03 BC019287 NM_001833  
HGE097678 M01C044D06 pDONR221 MGC11-H03 BC019287 NM_001833  
HGE097726 M01C044F06 pDONR221 MGC11-H03 BC019287 NM_001833  
HGE097774 M01C044H06 pDONR221 MGC11-H03 BC019287 NM_001833  
HGE097822 M01C044J06 pDONR221 MGC11-H03 BC019287 NM_001833  
HGE097870 M01C044L06 pDONR221 MGC11-H03 BC019287 NM_001833  
HGE097918 M01C044N06 pDONR221 MGC11-H03 BC019287 NM_001833  
HGE097966 M01C044P06 pDONR221 MGC11-H03 BC019287 NM_001833  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR067374 ARe68H06 pKA1U5 NM_001833.2  
GCTCCTGGCGCTTGTCCTCCTCTCCCAGTCGGCACCACAGCGGTGGCTGCCGGGCGTGGT
HKR078430 ARe96B06 pKA1U5 NM_001833.2  
GGTCTCCCTCCTGGCGCTTGTCCTCCTCTCCCAGTCGGCACCACAGCGGTGGCTGCCGGG
HKR174829 ARi37B05 pGCAP10 NM_001833.2  
GCTCTCCCTCCTGGCGCTTGTCCTCCTCTCCCAGTCGGCACCACAGCGGTGGCTGCCGGG
HKR234227 ARiS085J11 pGCAP10 NM_001833.2  
GCTCCTGGCGCTTGTCCTCCTCTCCCAGTCGGCACCACAGCGGTGGCTGCCGGGCGTGGT
HKR346971 RBb67H03 pGCAP1 NM_001833.2  
AAATGTGTTTTTACCCGTCTCCCTCCTGGCGCTTGTCCTCCTCTCCCAGTCGGCACCACA
HKR369303 RBd23E07 pGCAP10 NM_001833.2  
GGCTTCCGCTTTACCCGTCTCCCTCCTGGCGCTTGTCCTCCTCTCCCAGTCGGCACCACA
HKR377328 RBd43F08 pGCAP10 NM_001833.2  
GGCTTCCGCTTTACCCGTCTCCCTCCTGGCGCTTGTCCTCCTCTCCCAGTCGGCACCACA
HKR398905 RBd97E09 pGCAP10 NM_001833.2  
GGTCCTCCTCTCCCAGTCGGCACCACAGCGGTGGCTGCCGGGCGTGGTGTCGGTGGGTCG
HKR405620 RBdS014A20 pGCAP10 NM_001833.2  
GAGGGCTTCCGCTTTACCCGTCTCCCTCCTGGCGCTTGTCCTCCTCTCCCAGTCGGCACC
HKR405846 RBdS014K06 pGCAP10 NM_001833.2  
GACCCGTCTCCCTCCTGGCGCTTGTCCTCCTCTCCCAGTCGGCACCACAGCGGTGGCTGC
HKR432542 RBdS081F22 pGCAP10 NM_001833.2  
GGCTTTACCCGTCTCCCTCCTGGCGCTTGTCCTCCTCTCCCAGTCGGCACCACAGCGGTG
HKR433235 RBdS083B11 pGCAP10 NM_001833.2  
GACCCGTCTCCCTCCTGGCGCTTGTCCTCCTCTCCCAGTCGGCACCACAGCGGTGGCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl