Prev. | 

RIKEN DNA Bank Human Resource - CLPTM1

Gene ID NCBI Gene 1209 |  KEGG hsa:1209
Gene Symbol CLPTM1
Protein Name CLPTM1, transmembrane protein
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085800 IRAL014I08 pOTB7 BC004865 NM_001294 Partial
HGY091961 IRAL029P01 pOTB7 BC012359 NM_001294 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE127217 M01C118A17 pDONR221 4_5-A09 AK075262 ENST00000337392  
HGE085202 M01C013A02 pDONR221 FLJ04-B01 AK075262 ENST00000337392  
HGE085250 M01C013C02 pDONR221 FLJ04-B01 AK075262 ENST00000337392  
HGE085298 M01C013E02 pDONR221 FLJ04-B01 AK075262 ENST00000337392  
HGE085346 M01C013G02 pDONR221 FLJ04-B01 AK075262 ENST00000337392  
HGE085394 M01C013I02 pDONR221 FLJ04-B01 AK075262 ENST00000337392  
HGE085442 M01C013K02 pDONR221 FLJ04-B01 AK075262 ENST00000337392  
HGE085490 M01C013M02 pDONR221 FLJ04-B01 AK075262 ENST00000337392  
HGE085538 M01C013O02 pDONR221 FLJ04-B01 AK075262 ENST00000337392  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR171275 ARi28D03 pGCAP10 NM_001294.1  
GGGGGGCGGGGACCCGGAGCGGGAAGATGGCGGCGGCGCAGGAGGCGGACGGGGCCCGCA
HKR389259 RBd73C11 pGCAP10 NM_001294.1  
GAAGATGGCGGCGGCGCAGGAGGCGGACGGGGCCCGCAGCGCCGTGGTGGCGGCCGGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl