Prev. |  KEGG KO K05019 > 

RIKEN DNA Bank Human Resource - CLNS1A

Gene ID NCBI Gene 1207 |  KEGG hsa:1207
Gene Symbol CLNS1A
Protein Name chloride nucleotide-sensitive channel 1A
Synonyms CLCI|CLNS1B|ICln
Ortholog resources KEGG ortholog (KEGG orthology K05019) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR072547 ARe81G03 pKA1U5 NM_001293.1  
GGCCTCTTCCAGGGCGGGCGGTGTGGTGCACGCATTGCTGTGCTCCAACTCCCTCAGGGC
HKR183676 ARi59D04 pGCAP10 NM_001293.1  
CGGCCGGCCGATGCTCTTCCAGGGCGGGCGGTGTGGTGCACGCATTGCTGTGCTCNNCTC
HKR222170 ARiS055H02 pGCAP10 NM_001293.1  
GTTCCAGGGCGGGCGGTGTGGTGCACGCATTGCTGTGCTCCAACTCCCTCAGGGCCTGTG
HKR235440 ARiS088J24 pGCAP10 NM_001293.1  
GATTGCTGTGCTCCAACTCCCTCAGGGCCTGTGTTGCCGCACTCTGCTGCTATGAGCTTC
HKR264748 ARiS161O12 pGCAP10 NM_001293.1  
GCTCTTCCAGGGCGGGCGGTGTGGTGCACGCATTGCTGTGCTCCAACTCCCTCAGGGCCT
HKR367682 RBd19D10 pGCAP10 NM_001293.1  
GGGGCGGTGTGGTGCACGCATTGCTGTGCTCCAACTCCCTCAGGGCCTGTGTTGCCGCAC
HKR368507 RBd21E11 pGCAP10 NM_001293.1  
GCTCTTCCAGGGCGGGCGGTGTGGTGCACGCATTGCTGTGCTCCAACTCCCTCAGGGCCT
HKR372475 RBd31D03 pGCAP10 NM_001293.1  
GGGGCGGTGTGGTGCACGCATTGCTGTGCTCCAACTCCCTCAGGGCCTGTGTTGCCGCAC
HKR385748 RBd64G04 pGCAP10 NM_001293.1  
GATTGCTGTGCTCCAACTCCCTCAGGGCCTGTGTTGCCGCACTCTGCTGCTATGAGCTTC
HKR392124 RBd80F04 pGCAP10 NM_001293.1  
GGGGGNGGGGGGAGTGGTGNNCGCNTTGCTGAGNTCCNCCTCCNNNGNGGNCTGGGTTGC
HKR398152 RBd95G08 pGCAP10 NM_001293.1  
GGCCTCTTCCAGGGCGGGCGGTGTGGTGCACGCATTGCTGTGCTCCAACTCCCTCAGGGC
HKR405376 RBdS013H08 pGCAP10 NM_001293.1  
GACTGCCTCTTCCAGGGCGGGCGGTGTGGTGCACGCATTGCTGTGCTCCAACTCCCTCAG
HKR406010 RBdS015A10 pGCAP10 NM_001293.1  
GGCTGTGCTCCAACTCCCTCAGGGCCTGTGTTGCCGCACTCTGCTGCTATGAGCTTCCTC
HKR430276 RBdS075L12 pGCAP10 NM_001293.1  
GGGGCGGTGTGGTGCACGCATTGCTGTGCTCCAACTCCCTCAGGGCCTGTGTTGCCGCAC
HKR441980 RBdS104P20 pGCAP10 NM_001293.1  
GATTGCTGTGCTCCAACTCCCTCAGGGCCTGTGTTGCCGCACTCTGCTGCTATGAGCTTC
HKR444097 RBdS110E01 pGCAP10 NM_001293.1  
GCCCTTCCAGGGCGGGCGGTGTGGTGCACGCATTGCTGTGCTCCAACTCCCTCAGGGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl