Prev. |  KEGG KO K08823 > 

RIKEN DNA Bank Human Resource - CLK1

Gene ID NCBI Gene 1195 |  KEGG hsa:1195
Gene Symbol CLK1
Protein Name CDC like kinase 1
Synonyms CLK|CLK/STY|STY
Ortholog resources KEGG ortholog (KEGG orthology K08823) in the DNA Bank
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010781 IRAK026P21 pCMV-SPORT6 BC031549 NM_004071 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR336576 RBb41H08 pGCAP1 NM_004071.2  
TGGATTTTGTTGTTGGTGCGCGACGCAGTCAGCTGCGTGATTCCCGTGATTGCGTTACAA
HKR390147 RBd75G03 pGCAP10 NM_004071.2  
TGGCTGCGTCATCAGTGTTTTCGAGACGAGTCTCGACGCAGCAGCTGTCAGCTCCATTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl