Prev. |  KEGG KO K05021 > 

RIKEN DNA Bank Human Resource - CLIC1

Gene ID NCBI Gene 1192 |  KEGG hsa:1192
Gene Symbol CLIC1
Protein Name chloride intracellular channel 1
Synonyms CL1C1|G6|NCC27
Ortholog resources KEGG ortholog (KEGG orthology K05021) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX055702 IRAK139E06 pCMV-SPORT6 BC064527 NM_001288 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE013628 W01A034B04 pENTR-TOPO IRAK139E06 BC064527 NM_001288  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049207 ARe23A07 pKA1U5 NM_001288.4  
GCCCGACGCAACCATGGCTGAAGAACAACCGCAGGCTCGAATTGTTCGTGAAGGCTGGCA
HKR050521 ARe26F01 pKA1U5 NM_001288.4  
GGAGGACCGAGCTGGAGGAGCTGGGTGTGGGGTGCGTTGGGCTGGTGGGGAGGCCTAGTT
HKR054033 ARe35B09 pKA1U5 NM_001288.4  
GAGAGGACCGAGCTGGAGGAGCTGGGTGTGGGGTGCGTTGGGCTGGTGGGGAGGCCTAGT
HKR062500 ARe56E04 pKA1U5 NM_001288.4  
GGCAACCATGGCTGAAGAACAACCGCAGGTCGNCCCTTTNAGTGAAGGCTGGCAGTGATG
HKR067697 ARe69E01 pKA1U5 NM_001288.4  
GAGCCCGGGAGAGGACCGAGCTGGAGGAGCTGGGTGTGGGGTGCGTTGGGCTGGTGGGGA
HKR080551 ARf01G07 pKA1U5 NM_001288.4  
GGAGGACCGAGCTGGAGGAGCTGGGTGTGGGGTGCGTTGGGCTGGTGGGGAGGCCTAGTT
HKR082153 ARf05G09 pKA1U5 NM_001288.4  
GAGGACCGAGCTGGAGGAGCTGGGTGTGGGGTGCGTTGGGCTGGTGGGGAGGCCTAGTTT
HKR164053 ARi10C05 pGCAP10 NM_001288.4  
GCTCTCTGATCCAGCCCGGGAGAGGACCGAGCTGGAGGAGCTGGGTGTGGGGTGCGTTGG
HKR170449 ARi26C01 pGCAP10 NM_001288.4  
GAGAGGACCGAGCTGGAGGAGCTGGGTGTGGGGTGCGTTGGGCTGGTGGGGAGGCCTAGT
HKR172405 ARi31A05 pGCAP10 NM_001288.4  
GGAGCTGGGTGTGGGGTGCGTTGGGCTGGTGGGGAGGCCTAGTTTGGGTGCAAGTAGGTC
HKR179351 ARi48G07 pGCAP10 NM_001288.4  
GACTTCCTGGTCCCCGACGCAACCATGGCTGAAGAACAACCGCAGGTCGAATTGTTCGTG
HKR183208 ARi58A08 pGCAP10 NM_001288.4  
GGAGCTGGGTGTGGGGTGCGTTGGGCTGGTGGGGANACCAACNTTGCGANCNGAAGATCG
HKR186083 ARi65D11 pGCAP10 NM_001288.4  
GAGCTGGGTGTGGGGTGCGTTGGGCTGGTGGGGAGGCCTAGTTTGGGTGCAAGTAGGTCT
HKR188105 ARi70E09 pGCAP10 NM_001288.4  
GGAGTCAGCGGCTCTCTGATCCAGCCCGGGAGAGGACCGAGCTGGAGGAGCTGGGTGTGG
HKR247266 ARiS118C18 pGCAP10 NM_001288.4  
GGCAACCATGGCTGAANAACAACCGCAGGTCGAATTGTTCGTGAAGGCTGGCAGTGATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl