Prev. |  KEGG KO K17252 > 

RIKEN DNA Bank Human Resource - CLU

Gene ID NCBI Gene 1191 |  KEGG hsa:1191
Gene Symbol CLU
Protein Name clusterin
Synonyms AAG4|APO-J|APOJ|CLI|CLU1|CLU2|KUB1|NA1/NA2|SGP-2|SGP2|SP-40|TRPM-2|TRPM2
Ortholog resources KEGG ortholog (KEGG orthology K17252) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX007948 IRAK019O12 pCMV-SPORT6 BC010514 NM_203339 Full
HGX011909 IRAK029M21 pCMV-SPORT6 BC019588 NM_203339 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040507 ARe01E11 pKA1U5 NM_001831.2  
HKR082971 ARf07H03 pKA1U5 NM_001831.2  
GGCGGCGTCGCCAGGAGGAGCGCGCGGGCACAGGGTTGCCGCTGACCGAGGCGTGCAAAG
HKR170970 ARi27H02 pGCAP10 NM_001831.2  
GGCGGCGTCGCCAGGAGGAGCGCGCGGGCACAGGGTGCCGCTGACCGAGGCGTGCAAAGA
HKR222007 ARiS055A07 pGCAP10 NM_001831.2  
GGCGGCGTCGCCAGGAGGAGCGCGCGGGCACAGGGTGCCGCTGACCGAGGCGTGCAAAGA
HKR406362 RBdS015P02 pGCAP10 NM_001831.2  
GGCGGCGTCGCCAGGAGGAGCGCGCGGGCACAGGGTGCCGCTGACCGAGGCGTGCAAAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl