Prev. |  KEGG KO K05016 > 

RIKEN DNA Bank Human Resource - CLCN7

Gene ID NCBI Gene 1186 |  KEGG hsa:1186
Gene Symbol CLCN7
Protein Name chloride voltage-gated channel 7
Synonyms CLC-7|CLC7|OPTA2|OPTB4|PPP1R63
Ortholog resources KEGG ortholog (KEGG orthology K05016) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008979 IRAK022H11 pCMV-SPORT6 BC015235 NM_001287
HGY085279 IRAL013D07 pOTB7 BC004946 NM_001287 Partial
HGY087369 IRAL018H01 pOTB7 BC006158 NM_001287 Partial/var
HGY090327 IRAL025N15 pOTB7 BC012737 NM_001287

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE016585 W01A041H17 pENTR-TOPO IRAL025N15 BC012737 NM_001287  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR190453 ARi76C05 pGCAP10 NM_001287.4  
GGTCGCGCGTCACGTGGCCGCCGGCGCGGGTCACGAGAACAAACACGGGGGCAGCCGGCG
HKR362051 RBd05C03 pGCAP10 NM_001287.4  
GCCCGTCGCGCGTCACGTGGCCGCCGGCGCGGGTCACGAGAACAAACACGGGGGCAGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl