Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AP2S1

Gene ID (NCBI) 1175
Gene Symbol AP2S1
Protein Name adaptor-related protein complex 2, sigma 1 subunit
Synonyms AP17|AP17-DELTA|CLAPS2|HHC3
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY087159 IRAL017O23 pOTB7 BC006337 NM_004069 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162432 ARi06B08 pGCAP10 NM_021575.2  
GAGTCCGCCGCGGGACCGGGGCCGCTGGGGTCTGGACGGGGGTCGCCATGATCCGCTTTA
HKR163726 ARi09F06 pGCAP10 NM_021575.2  
GGCCCTACAACTGCACCCTGAGCCGGAGCTGCCCAGTCGCCGCGGGACCGGGGCCGCTGG
HKR046459 ARe16C11 pKA1U5 NM_021575.2  
GGCCCTACAACTGCACCCTGAGCCGGAGCTGCCCAGTCGCCGCGGGACCGGGGCCGCTGG
HKR172434 ARi31B10 pGCAP10 NM_021575.2  
GGGGCCCTACAACTGCACCCTGAGCCGGAGCTGCCCAGTCGCCGCGGGACCGGGGCCGCT
HKR058528 ARe46F08 pKA1U5 NM_021575.2  
GTTTTTCTACCGGAAGTCCGCTCTAGCTCTGGGCCCTACAACTGCACCCTGAGCCGGAGC
HKR060049 ARe50C01 pKA1U5 NM_021575.2  
GCTACAACTGCACCCTGAGCCGGAGCTGCCCAGTCGCCGCGGGACCGGGGCCGCTGGGGT
HKR065254 ARe63C06 pKA1U5 NM_021575.2  
GAACTGCACCCTGAGCCGGAGCTGCCCAGNTCGCCGCGGGACCGGGGCCGCTGGGGTCTG
HKR184812 ARi62A12 pGCAP10 NM_021575.2  
GGCCCTACAACTGCACCCTGAGCCGGAGCTGCCCAGTCGCCGCGGGACCGGGGCCGCTGG
HKR069731 ARe74F11 pKA1U5 NM_021575.2  
GCTACAACTGCACCCTGAGCCGGAGCTGCCCAGCTCGCCGCGGGACCGGGGCCGCTGGGG
HKR209572 ARiS023P12 pGCAP10 NM_021575.2  
GCTAGCTCTGGGCCCTACAACTGCACCCTGAGCCGGAGCTGCCCAGTCGCCGCGGGACCG
HKR344927 RBb62F07 pGCAP1 NM_021575.2  
GGCCCTACAACNTGCACCCTGNGCCGGNGCTTGCCCAGTCGCCGCGGGACCGGGGCCGCT
HKR386132 RBd65F12 pGCAP10 NM_021575.2  
GCTGGGCCCTACAACTGCACCCTGAGCCGGAGCTGCCCAGTCGCCGCGGGACCGGGGCCG
HKR392545 RBd81G01 pGCAP10 NM_021575.2  
GAGTCGCCGCGGGACCGGGGCCGCTGGGGTCTGGACGGGGGTCGCCATGATCCGCTTTAT
HKR428379 RBdS070P19 pGCAP10 NM_021575.2  
GCTGGGCCCTACAACTGCACCCTGAGCCGGAGCTGCCCAGTCGCCGCGGGACCGGGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl