Prev. |  KEGG KO K02219 > 

RIKEN DNA Bank Human Resource - CKS2

Gene ID NCBI Gene 1164 |  KEGG hsa:1164
Gene Symbol CKS2
Protein Name CDC28 protein kinase regulatory subunit 2
Synonyms CKSHS2
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  CKS2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083391 IRAL008H23 pOTB7 BC006458 NM_001827 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048177 ARe20H09 pKA1U5 NM_001827.1  
GGTTAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTC
HKR048478 ARe21D06 pKA1U5 NM_001827.1  
GAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTCTTC
HKR070906 ARe77E10 pKA1U5 NM_001827.1  
GAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACNCTGNTTTTTGTCTGCTGCGCCCGCTCT
HKR247475 ARiS118L11 pGCAP10 NM_001827.1  
GTTAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTCT
HKR277834 ARiS194J18 pGCAP10 NM_001827.1  
GGTTANTNTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTC
HKR327628 RBb19B04 pKA1U5 NM_001827.1  
GAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTTGTCTGCTGCGCCCGCTCTT
HKR363373 RBd08H05 pGCAP10 NM_001827.1  
GGTTAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTC
HKR372102 RBd30E06 pGCAP10 NM_001827.1  
GAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTCTTC
HKR374010 RBd35A10 pGCAP10 NM_001827.1  
CGGCCGGCCGATGAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTG
HKR375653 RBd39C05 pGCAP10 NM_001827.1  
GAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTCTTC
HKR388547 RBd71G03 pGCAP10 NM_001827.1  
TTGAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTCT
HKR405507 RBdS013M19 pGCAP10 NM_001827.1  
GGTTAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTC
HKR441667 RBdS104C19 pGCAP10 NM_001827.1  
GAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTCTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl