Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CKS2

Gene ID (NCBI) 1164
Gene Symbol CKS2
Protein Name CDC28 protein kinase regulatory subunit 2
Synonyms CKSHS2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083391 IRAL008H23 pOTB7 BC006458 NM_001827 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048177 ARe20H09 pKA1U5 NM_001827.1  
GGTTAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTC
HKR048478 ARe21D06 pKA1U5 NM_001827.1  
GAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTCTTC
HKR070906 ARe77E10 pKA1U5 NM_001827.1  
GAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACNCTGNTTTTTGTCTGCTGCGCCCGCTCT
HKR247475 ARiS118L11 pGCAP10 NM_001827.1  
GTTAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTCT
HKR277834 ARiS194J18 pGCAP10 NM_001827.1  
GGTTANTNTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTC
HKR363373 RBd08H05 pGCAP10 NM_001827.1  
GGTTAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTC
HKR327628 RBb19B04 pKA1U5 NM_001827.1  
GAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTTGTCTGCTGCGCCCGCTCTT
HKR372102 RBd30E06 pGCAP10 NM_001827.1  
GAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTCTTC
HKR374010 RBd35A10 pGCAP10 NM_001827.1  
CGGCCGGCCGATGAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTG
HKR375653 RBd39C05 pGCAP10 NM_001827.1  
GAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTCTTC
HKR388547 RBd71G03 pGCAP10 NM_001827.1  
TTGAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTCT
HKR405507 RBdS013M19 pGCAP10 NM_001827.1  
GGTTAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTC
HKR441667 RBdS104C19 pGCAP10 NM_001827.1  
GAGTCTCCGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCCGCTCTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl