Prev. |  KEGG KO K00933 > 

RIKEN DNA Bank Human Resource - CKMT1B

Gene ID NCBI Gene 1159 |  KEGG hsa:1159
Gene Symbol CKMT1B
Protein Name creatine kinase, mitochondrial 1B
Synonyms CKMT|CKMT1|UMTCK
Ortholog resources KEGG ortholog (KEGG orthology K00933) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR322931 RBb07F11 pKA1U5 NM_020990.3  
GACTAGCTCATTGCGCCTCTCCTGCAGTCTGATTGGCACCGGCTCCCATTCCGGCTCCAG
HKR336128 RBb40F08 pGCAP1 NM_020990.3  
GATTCCGGCTCCAGCCTCCAATCCGACCCCCATTTCGGCTGCAGCCTCGGACCTAGCTCC
HKR406138 RBdS015F18 pGCAP10 NM_020990.3  
GATTGCGCCTCTCCTGCAGTCTGATTGGCACCGGCTCCCATTCCGGCTCCAGCCTCCAAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl