Prev. |  KEGG KO K17262 > 

RIKEN DNA Bank Human Resource - TBCB

Gene ID NCBI Gene 1155 |  KEGG hsa:1155
Gene Symbol TBCB
Protein Name tubulin folding cofactor B
Synonyms CG22|CKAP1|CKAPI
Ortholog resource in our bank

  TBCB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046362 IRAK115P02 pCMV-SPORT6 BC052812 NM_001281 Full
HGY088753 IRAL021O17 pDNR-LIB BC005969 NM_001281 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052073 ARe30D01 pKA1U5 NM_001281.2  
GAGCAGCGGCGGCGGCGGCTGCGGAGCGGGTGTGAGGCGGCTGGACCGCGCTGCAGGCAT
HKR062406 ARe56A06 pKA1U5 NM_001281.2  
GAGCCCAGCAGCAGCAGCGGCGGCGGCGGCTGCCCTANCNGGTGTGAGGCGGCTGGACCG
HKR078449 ARe96C01 pKA1U5 NM_001281.2  
TGATCCGCAGGGCGCGGCAAGATGGAGGTGACGGGGGTGTCGGCACCCACGGNTGACCGT
HKR176551 ARi41G07 pGCAP10 NM_001281.2  
GATCCGCAGGGCGCGGCAAGATGGAGGTGACGGGGGTGTCGGCACCCACGGTGACCGTTT
HKR323727 RBb09F07 pKA1U5 NM_001281.2  
GGAGCGGGTGTGAGGCGGCTGGACCGCGCTGCAGGCATCCGCAGGGCGCGGCAAGATGGA
HKR361325 RBd03F05 pGCAP10 NM_001281.2  
GAGCAGCGGCGGCGGCGGCTGCGGAGCGGGTGTGAGGCGGCTGGACCGCGCTGCAGGCAT
HKR363771 RBd09H03 pGCAP10 NM_001281.2  
GACCGCGCTGCAGGCATCCGCAGGGCGCGGCAAGATGGAGGTGACGGGGGTGTCGGCAC
HKR395703 RBd89E07 pGCAP10 NM_001281.2  
GGGCGGCGGCTGCGGAGCGGGTGTGAGGCGGCTGGACCGCGCTGCAGGCATCCGCAGGGC
HKR398428 RBd96B04 pGCAP10 NM_001281.2  
GGGCGGCGGCTGCGGAGCGGGTGTGAGGCGGCTGGACCGCGCTGCAGGCATCCGCAGGGC
HKR405863 RBdS014K23 pGCAP10 NM_001281.2  
GGATAGCCCAGCAGCAGCAGCGGCGGCGGCGGCTGCGGAGCGGGTGTGAGGCGGCTGGAC
HKR470820 RBdS177A20 pGCAP10 NM_001281.2  
GAGGGCGCGGCAAGATGGAGGTGACGGGGGTGTCGGCACCCACGGTGACCGTTTTCATCA
HKR471138 RBdS177O02 pGCAP10 NM_001281.2  
GAGCAGCGGCGGCGGCGGCTGCGGAGCGGGTGTGAGGCGGCTGGACCGCGCTGCAGGCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl