Prev. |  KEGG KO K13195 > 

RIKEN DNA Bank Human Resource - CIRBP

Gene ID NCBI Gene 1153 |  KEGG hsa:1153
Gene Symbol CIRBP
Protein Name cold inducible RNA binding protein
Synonyms CIRP
Ortholog resource in our bank

  CIRBP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001355 IRAK003G11 pCMV-SPORT6 BC000901 NM_001280 Full
HGY080642 IRAL001K02 pOTB7 BC000403 NM_001280 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE000435 W01A001B11 pENTR-TOPO IRAK003G11 BC000901 NM_001280  
HGE000437 W01A001B13 pENTR-TOPO IRAK003G11 BC000901 NM_001280  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041705 ARe04E09 pKA1U5 NM_001280.2  
GCTCACTCGCGCGTTAGGAGGCTCGGGTCGTTGTGGTGCGCTGTCTTCCCGCTTGCGTCA
HKR064883 ARe62D11 pKA1U5 NM_001280.2  
GCTCACTCGCGCGTTAGGAGGCTCGGGTCGTTGTGGTGCGCTGTCTTCCCGCTTGCGTCA
HKR066474 ARe66D02 pKA1U5 NM_001280.2  
GACTCGCGCGTTAGGAGGCTCGGGTCGTTGTGGTGCGCTGTCTTCCCGCTTGCGTCAGGG
HKR188460 ARi71C12 pGCAP10 NM_001280.2  
GCTCCTCACTCGCGCGTTAGGAGGCTCGGGTCGTTGTGGTGCGCTGTCTTCCCGCTTGCG
HKR203306 ARiS008E10 pGCAP10 NM_001280.2  
GACTCGCGCGTTAGGAGGCTCGGGTCGTTGTGGTGCGCTGTCTTCCCGCTTGCGTCAGGG
HKR234384 ARiS085P24 pGCAP10 NM_001280.2  
GCCCCTCACTCGCGCGTTAGGAGGCTCGGGTCGTTGTGGTGCGCTGTCTTCCCGCTTGCG
HKR248964 ARiS122G20 pGCAP10 NM_001280.2  
GCTCACTCGCGCGTTAGGAGGCTCGGGTCGTTGTGGTGCGCTGTCTTCCCGCTTGCGTCA
HKR332879 RBb32D07 pGCAP1 NM_001280.2  
GTCACTCGCGCGTTAGGAGGCTCGGGTCGTTGTGGTGCGCTGTCTTCCCGCTTGCGTCAG
HKR378947 RBd47G03 pGCAP10 NM_001280.2  
GCTCACTCGCGCGTTAGGAGGCTCGGGTCGTTGTGGTGCGCTGTCTTCCCGCTTGCGTCA
HKR383706 RBd59E10 pGCAP10 NM_001280.2  
GCCCTCACTCGCGCGTTAGGAGGCTCGGGTCGTTGTGGTGCGCTGTCTTCCCGCTTGCGT
HKR394008 RBd85A08 pGCAP10 NM_001280.2  
GCTCACTCGCGCGTTAGGAGGCTCGGGTCGTTGTGGTGCGCTGTCTTCCCGCTTGCGTCA
HKR394524 RBd86F04 pGCAP10 NM_001280.2  
GCCCTCACTCGCGCGTTAGGAGGCTCGGGTCGTTGTGGTGCGCTGTCTTCCCGCTTGCGT
HKR405723 RBdS014F03 pGCAP10 NM_001280.2  
GCTCACTCGCGCGTTAGGAGGCTCGGGTCGTTGTGGTGCGCTGTCTTCCCGCTTGCGTCA
HKR475149 RBdS187O13 pGCAP10 NM_001280.2  
GCTCACTCGCGCGTTAGGAGGCTCGGGTCGTTGTGGTGCGCTGTCTTCCCGCTTGCGTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl