Prev. |  KEGG KO K04816 > 

RIKEN DNA Bank Human Resource - CHRND

Gene ID NCBI Gene 1144 |  KEGG hsa:1144
Gene Symbol CHRND
Protein Name cholinergic receptor nicotinic delta subunit
Synonyms ACHRD|CMS2A|CMS3A|CMS3B|CMS3C|FCCMS|SCCMS
Ortholog resources KEGG ortholog (KEGG orthology K04816) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR391749 RBd79G05 pGCAP10 NM_000751.1  
GATCCGGCACCTGTTTCAAGAGAAGGGCTACAACAAAGAGCTCCGGCCCGTGGCACACAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl