Prev. |  KEGG KO K04812 > 

RIKEN DNA Bank Human Resource - CHRNB1

Gene ID NCBI Gene 1140 |  KEGG hsa:1140
Gene Symbol CHRNB1
Protein Name cholinergic receptor nicotinic beta 1 subunit
Synonyms ACHRB|CHRNB|CMS1D|CMS2A|CMS2C|SCCMS
Ortholog resources KEGG ortholog (KEGG orthology K04812) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005545 IRAK013O09 pCMV-SPORT6 BC011371 NM_000747 Full
HGY090883 IRAL027D11 pOTB7 BC023553 NM_000747 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE007226 W01A018B02 pENTR-TOPO IRAK013O09 BC011371 NM_000747  
HGE007230 W01A018B06 pENTR-TOPO IRAK013O09 BC011371 NM_000747  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050008 ARe25A08 pKA1U5 NM_000747.2  
GGGGCTCCTCGTCACTTCCCCTGTGCTGGCGGTCCCAGCGGCTCTCTGAGCGAAGTCACT
HKR409035 RBdS022J19 pGCAP10 NM_000747.2  
GACTCCTCTTCCAGGTTCCAGCCTGAACTGTCTGCCCCTGATCTGCGGCGATTTATCGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl