Prev. |  KEGG KO K14156 > 

RIKEN DNA Bank Human Resource - CHKB

Gene ID NCBI Gene 1120 |  KEGG hsa:1120
Gene Symbol CHKB
Protein Name choline kinase beta
Synonyms CHETK|CHKL|CK|CKB|CKEKB|EK|EKB|MDCMC
Ortholog resource in our bank

  CHKB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX047805 IRAK119I13 pCMV-SPORT6 BC056404 NM_005198 Full/var
HGY092383 IRAL030P23 pOTB7 BC037162 NM_152253 Full
HGY103877 IRAL059L13 pOTB7 BC082263 NM_005198 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE023569 W01A058P09 pENTR-TOPO IRAL059L13 BC082263 NM_005198  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR051308 ARe28E12 pKA1U5 NM_005198.3  
TATGGGGGCCCGGTCGAGCCCGCGCCATGGCGGCCGAGGCGACAGCTGTGGCCGGAAGCG
HKR452907 RBdS132E11 pGCAP10 NM_005198.3  
GAGCCTGGCCTGGGGCCCGGTCGAGCCCGCGCCATGGCGGCCGAGGCGACAGCTGTGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl