Prev. |  KEGG KO K19990 > 

RIKEN DNA Bank Human Resource - CHGA

Gene ID NCBI Gene 1113 |  KEGG hsa:1113
Gene Symbol CHGA
Protein Name chromogranin A
Synonyms CGA
Ortholog resources KEGG ortholog (KEGG orthology K19990) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04117 pAxCALNLhCHGA (reverse) Shuttle vector to generate rAd harboring human CHGA
RDB03543 pAxCALNLhCHGA (forward) Shuttle vector to generate rAd harboring human CHGA (forward)
RDB05162 pAxCALNLhCHGA (forward) Shuttle vector to generate rAd harboring human CHGA (forward)
RDB05163 pAxCALNLhCHGA (reverse) Shuttle vector to generate rAd harboring human CHGA (reverse)

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082636 IRAL006J20 pOTB7 BC006459 NM_001275 Full
HGY083174 IRAL007P14 pOTB7 BC001059 NM_001275 Full
HGY089911 IRAL024M23 pOTB7 BC012755 NM_001275 Partial
HGY090575 IRAL026H07 pOTB7 BC009384 NM_001275 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR365750 RBd14G06 pGCAP10 NM_001275.3  
GGGGGCGCGAGGGCGCTGCTGCTGCCACCGCTCCTGCCACTGCAGTGCTCGAGCCCCGTG
HKR376975 RBd42H07 pGCAP10 NM_001275.3  
GGCCACCGCTCCTGCCACTGCAGTGCTCGAGCCCCGTGCAGGGGAGCTTGCGGGAGGATC
HKR462773 RBdS156P13 pGCAP10 NM_001275.3  
GGCCANCNCTCCTGCCACTGCAGTGCTCGAGCCCCGTGCAGGGGAGCTTGCGGGAGGATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl