DNA Bank Top |  KEGG KO K19990 > 

RIKEN DNA Bank Human Resource - CHGA

Gene ID NCBI Gene 1113 |  KEGG hsa:1113
Gene Symbol CHGA
Protein Name chromogranin A
Synonyms CGA|PHE5|PHES

Link

Ortholog resource in our bank

  CHGA

External database

human CHGA

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB05163 pAxCALNLhCHGA (reverse) Shuttle vector to generate rAd harboring human CHGA (reverse)    
RDB05162 pAxCALNLhCHGA (forward) Shuttle vector to generate rAd harboring human CHGA (forward)    
RDB04117 pAxCALNLhCHGA (reverse) Shuttle vector to generate rAd harboring human CHGA    
RDB03543 pAxCALNLhCHGA (forward) Shuttle vector to generate rAd harboring human CHGA (forward)    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082636 IRAL006J20 pOTB7 BC006459 NM_001275 Full
HGY083174 IRAL007P14 pOTB7 BC001059 NM_001275 Full
HGY089911 IRAL024M23 pOTB7 BC012755 NM_001275 Partial
HGY090575 IRAL026H07 pOTB7 BC009384 NM_001275 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR365750 RBd14G06 pGCAP10 NM_001275.3  
GGGGGCGCGAGGGCGCTGCTGCTGCCACCGCTCCTGCCACTGCAGTGCTCGAGCCCCGTG
HKR376975 RBd42H07 pGCAP10 NM_001275.3  
GGCCACCGCTCCTGCCACTGCAGTGCTCGAGCCCCGTGCAGGGGAGCTTGCGGGAGGATC
HKR462773 RBdS156P13 pGCAP10 NM_001275.3  
GGCCANCNCTCCTGCCACTGCAGTGCTCGAGCCCCGTGCAGGGGAGCTTGCGGGAGGATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

♦ No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
♦ A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
♦ Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
♦ Visualization of Organelles update (Dec 18, 2023)
♦ Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
♦ Autophagy and Mitophagy Updates (Aug 16, 2023)
♦ High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
♦ Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
♦ Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
♦ Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
♦ Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl