Prev. |  KEGG KO K20091 > 

RIKEN DNA Bank Human Resource - CHD2

Gene ID NCBI Gene 1106 |  KEGG hsa:1106
Gene Symbol CHD2
Protein Name chromodomain helicase DNA binding protein 2
Synonyms EEOC
Ortholog resources KEGG ortholog (KEGG orthology K20091) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068079 ARe70D07 pKA1U5 NM_001271.3  
GACACACACGGGCACAAGATGGCCGGAGAGGCAGCAGCACCCCGAGCTGTCAGGCGTTCC
HKR430013 RBdS075A13 pGCAP10 NM_001271.3  
GACACGGCACAAGATGGCCGGAGAGGCAGCAGCACCCCGAGCTGTCAGGCGTTCCGCCGC
HKR433507 RBdS083M19 pGCAP10 NM_001271.3  
GACNCGNCNCAAGATGGCCGGANAGGCAGCAGCACCCCGAGCTGTCNGGCGTTCCGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl