Prev. |  KEGG KO K01275 > 

RIKEN DNA Bank Human Resource - CTSC

Gene ID NCBI Gene 1075 |  KEGG hsa:1075
Gene Symbol CTSC
Protein Name cathepsin C
Synonyms CPPI|DPP-I|DPP1|DPPI|HMS|JP|JPD|PALS|PDON1|PLS
Featured content Lysosome (human)
Featured content Apoptosis - human
Ortholog resource in our bank

  CTSC

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081225 IRAL003B01 pOTB7 BC008059 NM_001814 Full/var
HGY091235 IRAL028B11 pOTB7 BC023559 NM_148170 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR208070 ARiS020C22 pGCAP10 NM_001814.4  
GACCGCTAGCCCGCAGCGCTCGGCTTCCTGGTAATTCTTCACCTCTTTTCTCAGCTCCCT
HKR208108 ARiS020E12 pGCAP10 NM_001814.4  
GACCGCTAGCCCGCANCGCTCGGCTTCCTGGTAATTCTTCACCTCTTTTCTCAGCTCCCT
HKR234200 ARiS085I08 pGCAP10 NM_001814.4  
GACCGCTAGCCCGCAGCGCTCGGCTTCCTGGTAATTCTTCACCTCTTTTCTCAGCTCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl