Prev. |  KEGG KO K05765 > 

RIKEN DNA Bank Human Resource - CFL1

Gene ID NCBI Gene 1072 |  KEGG hsa:1072
Gene Symbol CFL1
Protein Name cofilin 1
Synonyms CFL|HEL-S-15|cofilin
Ortholog resources KEGG ortholog (KEGG orthology K05765) in the DNA Bank
Featured content Axon guidance - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX007753 IRAK019G09 pCMV-SPORT6 BC018256 NM_005507 Full
HGX008565 IRAK021G21 pCMV-SPORT6 BC012265 NM_005507 Full
HGY089455 IRAL023K15 pOTB7 BC012318 NM_005507 Full
HGY090358 IRAL025O22 pOTB7 BC011005 NM_005507 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE028451 W01A071C03 pENTR-TOPO flj0043c14 AK097690 NM_005507  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045302 ARe13E06 pKA1U5 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR047606 ARe19A06 pKA1U5 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR047632 ARe19B08 pKA1U5 NM_005507.2  
GAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCTC
HKR049279 ARe23D07 pKA1U5 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR049604 ARe24A04 pKA1U5 NM_005507.2  
GAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCTC
HKR054922 ARe37F02 pKA1U5 NM_005507.2  
GAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCTC
HKR055346 ARe38G02 pKA1U5 NM_005507.2  
GCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCCCGTTCTTCTGCGGCTCTCGGTGCCCTC
HKR056029 ARe40B05 pKA1U5 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGATCTTCTGCGGCTCTCGGTGCC
HKR056836 ARe42B12 pKA1U5 NM_005507.2  
ATCCTGGAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGC
HKR058005 ARe45A05 pKA1U5 NM_005507.2  
GGCGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGC
HKR058431 ARe46B07 pKA1U5 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGATCTTCTGCGGCTCTCGGTGCC
HKR058850 ARe47C02 pKA1U5 NM_005507.2  
GAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCTC
HKR067252 ARe68C04 pKA1U5 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR068503 ARe71E07 pKA1U5 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTNTCGATCTTCTGCGGCTCTCGGTGCC
HKR070860 ARe77C12 pKA1U5 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGATCTTCTGCGGCTCTCGGTGCC
HKR072881 ARe82D09 pKA1U5 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR078002 ARe95A02 pKA1U5 NM_005507.2  
GGTTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGATCTTCTGCGGCTCTCGGTGC
HKR078122 ARe95F02 pKA1U5 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR082460 ARf06C12 pKA1U5 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR163297 ARi08E01 pGCAP10 NM_005507.2  
GATTGTGCGGCTCCTACTAAACGGAAGGGGCCGGGAGAGGCCGCGTTCAGTCGGGTCCCG
HKR163332 ARi08F12 pGCAP10 NM_005507.2  
GCAAGCAAACTGCTACGAGGAGGTCAAGGACCGCTGCACCCTGGCAGAGAAGCTGGGGGG
HKR163353 ARi08G09 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR166010 ARi15A10 pGCAP10 NM_005507.2  
GAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCTC
HKR166978 ARi17H10 pGCAP10 NM_005507.2  
GCAAGCAAACTGCTACGAGGAGGTCAAGGACCGCTGCACCCTGGCAGAGAAGCTGGGGGG
HKR167226 ARi18B02 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR168098 ARi20E02 pGCAP10 NM_005507.2  
GCAAGCAAACTGCTACGAGGAGGTCAAGGACCGCTGCACCCTGGCAGAGAAGCTGGGGGG
HKR172401 ARi31A01 pGCAP10 NM_005507.2  
GCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCT
HKR177656 ARi44C08 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR179730 ARi49F10 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCACCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR180482 ARi51D10 pGCAP10 NM_005507.2  
GGGCTCCTACTAAACGGAAGGGGCCGGGAGAGGCCGCGTTCAGTCGGGTCCCGGCAGCGG
HKR180899 ARi52E03 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR180923 ARi52F03 pGCAP10 NM_005507.2  
GAATAAGATGAGGAACCGGAAAGCCCNCCAGAAAAGAAAACATCTACAAGCCCCCCACCC
HKR181777 ARi54H09 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR182547 ARi56G03 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR182972 ARi57H04 pGCAP10 NM_005507.2  
GGGCTCCTACTAAACGGAAGGGGCCGGGAGAGGCCGCGTTCAGTCGGGTCCCGGCAGCGG
HKR184528 ARi61F08 pGCAP10 NM_005507.2  
GAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCTC
HKR185724 ARi64F04 pGCAP10 NM_005507.2  
HKR186053 ARi65C05 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR186530 ARi66F10 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR186803 ARi67A03 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR187208 ARi68A08 pGCAP10 NM_005507.2  
GAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCTC
HKR188409 ARi71A09 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR205256 ARiS013C08 pGCAP10 NM_005507.2  
GAGGGGCCGGGAGAGGCCGCGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCT
HKR209333 ARiS023F13 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR209488 ARiS023L24 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR209571 ARiS023P11 pGCAP10 NM_005507.2  
GGTTCANTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR219669 ARiS049C21 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR222164 ARiS055G20 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR234194 ARiS085I02 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR234882 ARiS087D10 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR234897 ARiS087E01 pGCAP10 NM_005507.2  
GTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTC
HKR235131 ARiS087N19 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR238596 ARiS096I04 pGCAP10 NM_005507.2  
GAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCTC
HKR238620 ARiS096J04 pGCAP10 NM_005507.2  
GAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCTC
HKR238681 ARiS096L17 pGCAP10 NM_005507.2  
GAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCTC
HKR238694 ARiS096M06 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR243782 ARiS109H14 pGCAP10 NM_005507.2  
GAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCTC
HKR247411 ARiS118I19 pGCAP10 NM_005507.2  
GCAGTCGGGTCCCGGCAGCNGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCT
HKR247494 ARiS118M06 pGCAP10 NM_005507.2  
AGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR248845 ARiS122B21 pGCAP10 NM_005507.2  
GCCTTTTCGTTTCCGGAAACATGGCCTCCGGTGTGGCTGTCTCTGATGGTGTCATCAAGG
HKR249066 ARiS122L02 pGCAP10 NM_005507.2  
GGCCGCGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGG
HKR249119 ARiS122N07 pGCAP10 NM_005507.2  
GAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCTC
HKR249183 ARiS122P23 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR260230 ARiS150J14 pGCAP10 NM_005507.2  
HKR260303 ARiS150M15 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR264653 ARiS161K13 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR276439 ARiS191B15 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR277770 ARiS194H02 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR277856 ARiS194K16 pGCAP10 NM_005507.2  
GTCCTACTAAACGGAAGGGGCCGGGAGAGGCCGCGTTCAGTCGGGTCCCGGCAGCGGCTG
HKR322812 RBb07A12 pKA1U5 NM_005507.2  
TTGTCCTACTAAACGGAAGGGGCCGGGAGAGGCCGCGTTCAGTCGGGTCCCGGCAGCGGC
HKR324060 RBb10C12 pKA1U5 NM_005507.2  
GCAGTCGGGCTCCCGGCAGCGGCTGCAGCGCTCTCGTTCTTCTGCGGCTCTCGGTGCCCT
HKR333254 RBb33C06 pGCAP1 NM_005507.2  
AAAGGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTG
HKR334878 RBb37D06 pGCAP1 NM_005507.2  
GTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTC
HKR362029 RBd05B05 pGCAP10 NM_005507.2  
GGGAAGGGGCCGGGAGAGGCCGCGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCG
HKR365373 RBd13H05 pGCAP10 NM_005507.2  
TGGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCC
HKR368809 RBd22A09 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR374050 RBd35C02 pGCAP10 NM_005507.2  
GAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCTC
HKR374954 RBd37G10 pGCAP10 NM_005507.2  
GGCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTC
HKR375682 RBd39D10 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR377255 RBd43C07 pGCAP10 NM_005507.2  
GAGGGGCCGGGAGAGGCCGCGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCT
HKR382500 RBd56E04 pGCAP10 NM_005507.2  
GAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCNNNTCTCGGTGCCCTCTC
HKR382555 RBd56G11 pGCAP10 NM_005507.2  
GAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCTC
HKR389380 RBd73H12 pGCAP10 NM_005507.2  
GGTTCNNTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR392825 RBd82B01 pGCAP10 NM_005507.2  
GAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCTC
HKR392926 RBd82F06 pGCAP10 NM_005507.2  
GAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCTC
HKR398431 RBd96B07 pGCAP10 NM_005507.2  
TGGGGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTG
HKR399778 RBd99H10 pGCAP10 NM_005507.2  
GAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCTC
HKR402945 RBdS007G01 pGCAP10 NM_005507.2  
GGTTCNNTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR405730 RBdS014F10 pGCAP10 NM_005507.2  
GTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTC
HKR408876 RBdS022D04 pGCAP10 NM_005507.2  
GCGGGAGAGGCCGCGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCG
HKR442251 RBdS105K11 pGCAP10 NM_005507.2  
GAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCTC
HKR444115 RBdS110E19 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR444170 RBdS110H02 pGCAP10 NM_005507.2  
CGGCCGGCCGATGGGAAGGGGCCGGGAGAGGCCGCGTTCAGTCGGGTCCCGGCAGCGGCT
HKR444336 RBdS110N24 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR453038 RBdS132J22 pGCAP10 NM_005507.2  
GGTTCAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCC
HKR461794 RBdS154I02 pGCAP10 NM_005507.2  
TGAGTCGGGTCCCGGCAGCGGCTGCAGCGCTCTCGTCTTCTGCGGCTCTCGGTGCCCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.06.26

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl