Prev. |  KEGG KO K16466 > 

RIKEN DNA Bank Human Resource - CETN3

Gene ID NCBI Gene 1070 |  KEGG hsa:1070
Gene Symbol CETN3
Protein Name centrin 3
Synonyms CDC31|CEN3
Ortholog resource in our bank

  CETN3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086548 IRAL016G04 pDNR-LIB BC005383 NM_004365 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE107237 M01C068B13 pDONR221 06_08-G07 BC005383 NM_004365  
HGE107285 M01C068D13 pDONR221 06_08-G07 BC005383 NM_004365  
HGE107333 M01C068F13 pDONR221 06_08-G07 BC005383 NM_004365  
HGE107381 M01C068H13 pDONR221 06_08-G07 BC005383 NM_004365  
HGE107429 M01C068J13 pDONR221 06_08-G07 BC005383 NM_004365  
HGE107477 M01C068L13 pDONR221 06_08-G07 BC005383 NM_004365  
HGE107525 M01C068N13 pDONR221 06_08-G07 BC005383 NM_004365  
HGE107573 M01C068P13 pDONR221 06_08-G07 BC005383 NM_004365  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR218024 ARiS045A24 pGCAP10 NM_004365.2  
GGAACGGCTGTGGGCGTCTTGCTGCCTTGGGTAGGGGGTTAAAATCGTTCTTGAGANGAA
HKR334147 RBb35G03 pGCAP1 NM_004365.2  
GCTCTGTTGAACGGCTGTGGGCGTCTTGCTGCCTTGGGTAGGGGGTTAAAATCGTTCTTG
HKR338148 RBb45G04 pGCAP1 NM_004365.2  
GGTGGGCGTCTTGCTGCCTTGGGTAGGGGGTTAAAATCGTTCTTGAGAGGAACGTCTCTG
HKR432728 RBdS081N16 pGCAP10 NM_004365.2  
AGGANGTCCCTGAGGCCGCTGAGGTCGTTCGTGTCTGTTGAACGGCTGTGGGCGTCTTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl