Prev. |  KEGG KO K10840 > 

RIKEN DNA Bank Human Resource - CETN2

Gene ID NCBI Gene 1069 |  KEGG hsa:1069
Gene Symbol CETN2
Protein Name centrin 2
Synonyms CALT|CEN2
Ortholog resources KEGG ortholog (KEGG orthology K10840) in the DNA Bank
Featured content DNA repair (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085602 IRAL014A02 pOTB7 BC013873 NM_004344 Full
HGY086754 IRAL016O18 pDNR-LIB BC005334 NM_004344 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR170153 ARi25G09 pGCAP10 NM_004344.1  
GAGCGGACTCCTTTGGCTATGGCCTCCAACTTTAAGAAGGCAAACATGGCATCAAGTTCT
HKR345304 RBb63E08 pGCAP1 NM_004344.1  
GACACGTCGGTTGCCTAACAACCGGCAGCGGACTCCTTTGGCTATGGCCTCCAACTTTAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl