Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CETN2

Gene ID (NCBI) 1069
Gene Symbol CETN2
Protein Name centrin, EF-hand protein, 2
Synonyms CALT|CEN2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10840)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY085602 IRAL014A02 pOTB7 BC013873 NM_004344 Full
HGY086754 IRAL016O18 pDNR-LIB BC005334 NM_004344 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR170153 ARi25G09 pGCAP10 NM_004344.1  
GAGCGGACTCCTTTGGCTATGGCCTCCAACTTTAAGAAGGCAAACATGGCATCAAGTTCT
HKR345304 RBb63E08 pGCAP1 NM_004344.1  
GACACGTCGGTTGCCTAACAACCGGCAGCGGACTCCTTTGGCTATGGCCTCCAACTTTAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl