Prev. |  KEGG KO K11495 > 

RIKEN DNA Bank Human Resource - CENPA

Gene ID NCBI Gene 1058 |  KEGG hsa:1058
Gene Symbol CENPA
Protein Name centromere protein A
Synonyms CENP-A|CenH3
Ortholog resources KEGG ortholog (KEGG orthology K11495) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001728 IRAK004F08 pCMV-SPORT6 BC000881 NM_001809 Full/var
HGY084802 IRAL012A02 pOTB7 BC002703 NM_001809 Full
HGY087910 IRAL019M22 pDNR-LIB BC011013 NM_001809

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE039914 W01A099N02 pENTR-TOPO IRAL012A02 BC002703 NM_001809  
HGE039920 W01A099N08 pENTR-TOPO IRAL012A02 BC002703 NM_001809  
HGE050661 W01A126K21 pENTR-TOPO IRAL012A02 BC002703 NM_001809  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR385227 RBd63B03 pGCAP10 NM_001809.3  
GACCGGCTCATGTGAGGCTCGCGGCACAGCGTTCTCTGGGCTCCCCAGAAGCCAGCCTTT
HKR402944 RBdS007F24 pGCAP10 NM_001809.3  
GGGAGCGAGCGATTTGAACGCGAGCGGCGCGGACTTCTGCCAAGCACCGGCTCATGTGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl