Prev. |  KEGG KO K10050 > 

RIKEN DNA Bank Human Resource - CEBPD

Gene ID NCBI Gene 1052 |  KEGG hsa:1052
Gene Symbol CEBPD
Protein Name CCAAT enhancer binding protein delta
Synonyms C/EBP-delta|CELF|CRP3|NF-IL6-beta
Ortholog resource in our bank

  CEBPD

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01313 pBlue hNF-IL6 beta clone 10-1 Plasmid clone of human NF-IL-6beta cDNA
RDB02306 pAxCAhNF-IL6 beta (forward) Shuttle vector to produce rAd expressing human NF-IL6 beta
RDB02307 pAxCAhNF-IL6 beta (reverse) Shuttle vector to produce rAd expressing human NF-IL6 beta
RDB02747 AxCAhNF-IL6 beta (forward) Recombinant adenovirus harboring human NF-IL6 beta cDNA

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY121558 IRCB003O22 pCR4-TOPO BC105109 NM_005195 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR081353 ARf03G09 pKA1U5 NM_005195.3  
GGACAGCCTCGCTTGGACGCAGAGCCCGGCCCGACGCCGCCATGAGCGCCGCGCTCTTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.08.18

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl