Prev. |  KEGG KO K10048 > 

RIKEN DNA Bank Human Resource - CEBPB

Gene ID NCBI Gene 1051 |  KEGG hsa:1051
Gene Symbol CEBPB
Protein Name CCAAT enhancer binding protein beta
Synonyms C/EBP-beta|IL6DBP|NF-IL6|TCF5
Ortholog resource in our bank

  CEBPB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01314 pBlue hNF-IL6 (610 Sal I) Human NF-IL-6beta cDNA
RDB01354 pUChNF-IL6G16 Plasmid clone of human NF-IL-6 genomic DNA G16 (EcoR I/BamH I fragment)
RDB02356 pEF-NFIL6 delta Spl Expression vector for human NF-IL6 mutant
RDB07002 pCMFlag_hsCEBPB Expression vector of human CREBPB.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088937 IRAL022F17 pOTB7 BC007538 NM_005194 Full
HGY096286 IRAL040L22 pOTB7 BC021931 NM_005194 Full
HGY085839 IRAL014J23 pOTB7 BC005132 NM_005194 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE018277 W01A045L13 pENTR-TOPO IRAL022F17 BC007538 NM_005194 done
HGE018279 W01A045L15 pENTR-TOPO IRAL022F17 BC007538 NM_005194  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR174406 ARi36A06 pGCAP10 NM_005194.2  
GAGCGAGTCAGAGCCGCGCACGGGACTGGGAAGGGGACCCACCCGAGGGTCCAGCCACCA
HKR325632 RBb14B08 pKA1U5 NM_005194.2  
GAGTCAGAGCCGCGCACGGGACTGGNTAAGGGGACCCACCCGAGGGTCCAGCCACCAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl