Prev. |  KEGG KO K14167 > 

RIKEN DNA Bank Human Resource - CDKN3

Gene ID NCBI Gene 1033 |  KEGG hsa:1033
Gene Symbol CDKN3
Protein Name cyclin dependent kinase inhibitor 3
Synonyms CDI1|CIP2|KAP|KAP1
Ortholog resources KEGG ortholog (KEGG orthology K14167) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056216 IRAK140I24 pCMV-SPORT6 BC064965 NM_005192 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE021539 W01A053O03 pENTR-TOPO flj0053f09 AK098653 NM_005192  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046102 ARe15E06 pKA1U5 NM_005192.3  
GAGAGGGAGGCGGCACTGGTCTCGACGTGGGGCGGCCAGCGATGAAGCCGCCCAGTTCAA
HKR052904 ARe32E08 pKA1U5 NM_005192.3  
GGCGGGCTCGGCCGGGGCACCGGTGAGTCGCCGGCGCTGCAGAGGGAGGCGGCACTGGTC
HKR054034 ARe35B10 pKA1U5 NM_005192.3  
GGGGGCGCGGGCTCGGCCGGGGCACCGGATGAGCNCGCCGGCGCTGCAGAGGGAGGCGGC
HKR164835 ARi12B11 pGCAP10 NM_005192.3  
GACCGGTGAGTCGCCGGCGCTGCAGAGGGAGGCGGCACTGGTCTCGACGTGGGGCGGCCA
HKR164908 ARi12E12 pGCAP10 NM_005192.3  
GGGCACTGGTCTCGACGTGGGGCGGCCAGCGATGAAGCCGCCCAGTTCAATACAAACAAG
HKR172410 ARi31A10 pGCAP10 NM_005192.3  
TGACCGGTGAGTCGCCGGCGCTGCAGAGGGAGGCGGCACTGGTCTCGACGTGGGGCGGCC
HKR219748 ARiS049G04 pGCAP10 NM_005192.3  
GGGTGAGTCGCCGGCGCTGCAGAGGGAGGCGGCACTGGTCTCGACGTGGGGCGGCCAGCG
HKR234074 ARiS085D02 pGCAP10 NM_005192.3  
GGGGGGCGCGGGCTCGGCCGGGGCACCGGTGAGTCGCCGGCGCTGCAGAGGGAGGCGGCA
HKR234087 ARiS085D15 pGCAP10 NM_005192.3  
GGGGCTCGGCCGGGGCACCGGTGAGTCGCCGGCGCTGCAGAGGGAGGCGGCACTGGTCTC
HKR360951 RBd02G07 pGCAP10 NM_005192.3  
GGGGGCACCGGTGAGTCGCCGGCGCTGCAGAGGGAGGCGGCACTGGTCTCGACGTGGGGC
HKR396180 RBd90H12 pGCAP10 NM_005192.3  
GGGGGCGCGGACTCGGCTGGGGCACCGGCGAGGCGCCGGCGCTCTGAGGGAGGCGGCACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl