Prev. |  KEGG KO K06623 > 

RIKEN DNA Bank Human Resource - CDKN2D

Gene ID NCBI Gene 1032 |  KEGG hsa:1032
Gene Symbol CDKN2D
Protein Name cyclin dependent kinase inhibitor 2D
Synonyms INK4D|p19|p19-INK4D
Ortholog resource in our bank

  CDKN2D

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01995 pAxCMhp19 Shuttle vector to generate rAd expressing human CDKI p19
RDB05334 pAxCALNLhCDK7(forward) Shuttle vector to generate rAd expressing human CDKN2D
RDB05335 pAxCALNLhCDK7(reverse) Shuttle vector to generate rAd expressing human CDKN2D

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084701 IRAL011M13 pOTB7 BC001822 NM_079421 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024759 W01A061O23 pENTR-TOPO IRAL011M13 BC001822 NM_079421  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR187777 ARi69H09 pGCAP10 NM_001800.3  
GAGCAGCGCAGCCGGGTGCACCGCGGCCGCGCCCCGGGAGGGCTGTTCGGGCCAGCGCCC
HKR432484 RBdS081D12 pGCAP10 NM_001800.3  
GGGGGCGGGCGCCGGGCNGGNCCCCNCGGGCGGCCGANGGTTGNTCCCNNAACCTNTNNA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl