Prev. |  KEGG KO K06622 > 

RIKEN DNA Bank Human Resource - CDKN2C

Gene ID NCBI Gene 1031 |  KEGG hsa:1031
Gene Symbol CDKN2C
Protein Name cyclin dependent kinase inhibitor 2C
Synonyms INK4C|p18|p18-INK4C
Ortholog resources KEGG ortholog (KEGG orthology K06622) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006056 IRAK015C08 pCMV-SPORT6 BC016173 NM_078626 Full/var
HGX008822 IRAK022A22 pCMV-SPORT6 BC017036 NM_078626 Full
HGY082072 IRAL005C24 pOTB7 BC000598 NM_078626 Full
HGY087253 IRAL018C05 pOTB7 BC005041 NM_078626 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE028463 W01A071C15 pENTR-TOPO flj0015i05 AK091170 NM_078626  
HGE028467 W01A071C19 pENTR-TOPO flj0015i05 AK091170 NM_078626  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR209233 ARiS023B09 pGCAP10 NM_001262.2  
GAAGGAGGAAGCAGTGCTGCCAGGCTCTGCTCCAGGGCACAGCTGGCTGGCGGCTGCCCT
HKR276442 ARiS191B18 pGCAP10 NM_001262.2  
GGAGAGGCAACAGAAGCAGCAATTGTTTCAGCGAAAAAAGCAGCAAGGGAGGGAGTGAAG
HKR394499 RBd86E03 pGCAP10 NM_001262.2  
GAGAAGAAACCGGCACCCTCTCTGAGAGGCAACAGAAGCAGCAATTGTTTCAGCGAAAAA
HKR403027 RBdS007J11 pGCAP10 NM_001262.2  
GGTTAAAATGGGGGCGGGTTTTTCAACTCAAAAAGCGCTCAATTTTTTTCTTTTCAAAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl