Prev. |  KEGG KO K04685 > 

RIKEN DNA Bank Human Resource - CDKN2B

Gene ID NCBI Gene 1030 |  KEGG hsa:1030
Gene Symbol CDKN2B
Protein Name cyclin dependent kinase inhibitor 2B
Synonyms CDK4I|INK4B|MTS2|P15|TP15|p15INK4b
Ortholog resources KEGG ortholog (KEGG orthology K04685) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03480 pAxCALNLhCDKN2B (forward) Shuttle vector to generate rAd harboring human CDKN2B (forward)
RDB03579 pAxCALNLhCDKN2B (forward) Shuttle vector to generate rAd harboring human CDKN2B (forward)
RDB04067 pAxCALNLhCDKN2B (reverse) Shuttle vector to generate rAd harboring human CDKN2B (reverse)

webcatalog20210331.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY091510 IRAL028M22 pOTB7 BC018984 NM_078487
HGY093874 IRAL034L10 pOTB7 BC014469 NM_004936 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE024563 W01A061G19 pENTR-TOPO IRAL034L10 BC014469 NM_004936 done
HGE024567 W01A061G23 pENTR-TOPO IRAL034L10 BC014469 NM_004936  

♦ W series clone contains a stop codon.

GNP_entry_W01A_210404.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR249070 ARiS122L06 pGCAP10 NM_004936.3  
GACTCTGCCAGAGCGAGGCGGGGCAGTGAGGACTCCGCGACGCGTCCGCACCCTGCGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl