Prev. |  KEGG KO K06624 > 

RIKEN DNA Bank Human Resource - CDKN1B

Gene ID NCBI Gene 1027 |  KEGG hsa:1027
Gene Symbol CDKN1B
Protein Name cyclin dependent kinase inhibitor 1B
Synonyms CDKN4|KIP1|MEN1B|MEN4|P27KIP1
Featured content HIF-1 signaling pathway - human
Ortholog resource in our bank

  CDKN1B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB02010 AxCAhp27 Recombinant adenovirus expressing human CDKI p27 regulated by CAG promoter
RDB02011 pAxCAhp27 Shuttle vector to generate rAd expressing human CDKI p27
RDB02069 pAxCAhp27 (As) Shuttle vector to generate rAd expressing human CDKI p27
RDB04642 pAxCALNLhp27(reverse) Shuttle vector to generate rAd expressing human CDKN1B
RDB04645 pAxCALNLhp27(forward) Shuttle vector to generate rAd expressing human CDKN1B
RDB05508 pKM2L-phKIP1 Promoter Bank clone, Human p27 cyclin-dependent kinase inhibitor (kip1) promoter

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001654 IRAK004C06 pCMV-SPORT6 BC001971 NM_004064 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE031709 W01A079E13 pENTR-TOPO IRAK004C06 BC001971 NM_004064  
HGE031715 W01A079E19 pENTR-TOPO IRAK004C06 BC001971 NM_004064  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR260278 ARiS150L14 pGCAP10 NM_004064.3  
GCTTCGTCAGCCTCCCTTCCACCGCCATATTGGGCCACTAAAAAAAGGGGGCTCGTCTTT
HKR384436 RBd61B12 pGCAP10 NM_004064.3  
GAGCCAATCTCCCGGCGGCGCTCGGGGAGGCGGCGCGCTCGGGAACGAGGGGAGGTGGCG
HKR428168 RBdS070G24 pGCAP10 NM_004064.3  
GGTCAGCCTCCCTTCCACCGCCATATTGGGCCACTAAAAAAAGGGGGCTCGTCTTTTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.08.18

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl