Prev. |  KEGG KO K02211 > 

RIKEN DNA Bank Human Resource - CDK9

Gene ID NCBI Gene 1025 |  KEGG hsa:1025
Gene Symbol CDK9
Protein Name cyclin dependent kinase 9
Synonyms C-2k|CDC2L4|CTK1|PITALRE|TAK
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  CDK9

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001722 IRAK004F02 pCMV-SPORT6 BC001968 NM_001261 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR277632 ARiS194B08 pGCAP10 NM_001261.3  
GGGCCGCGGAGGGGCCTGGAGTGCGGCGGCGGCGGGACCCGGAGCAGGAGCGGCGGCAGC
HKR367655 RBd19C07 pGCAP10 NM_001261.3  
GAGTGGCGCGGCCGCGGAGGGGCCTGGAGTGCGGCGGCGGCGGGACCCGGAGCAGGAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl